
Izolacja ludzkiego genu, który hamuje zakażenie HIV-1


Szybka izolacja antygenów z komórek z adsorbentem gronkowcowym białko A-przeciwciało: parametry interakcji kompleksów przeciwciało-antygen z białkiem A.

Tulpina Cowan I a bacteriei Staphylococcus aureus a fost utilizată ca adsorbant pentru anticorpii complexați cu antigeni radiomarcați din   lizatele celulare . Această aplicație este avansată ca o alternativă superioară la alte metode de precipitare imună pentru izolarea antigenelor. Acesta exploatează capacitatea ridicată de adsorbție pentru moleculele IgG de către moleculele de proteină A de pe   pereții celulari ai anumitor tulpini de stafilococi, împreună cu proprietățile avantajoase de sedimentare ale bacteriilor. Interacțiunea complexelor imune cu adsorbantul a fost definită inițial utilizând un sistem mannequin de albumină serică bovină cu un exces mare de anticorpi anti-albumină serică bovină de iepure (IgG).

Absorbția complexelor imune în aceste condiții a fost extrem de rapidă, având loc în câteva secunde, în timp ce legarea maximă a IgG libere a fost mult mai lentă . În plus, odată legat antigenul complexat nu a putut fi deplasat din adsorbant nici prin cantități mari de IgG normale, nici prin anticorp suplimentar liber. Antigenul ar putea fi eluat aproape complet din adsorbantul inert în scopuri analitice sau preparative cu o varietate de sisteme de solvenți, cum ar fi detergentul SDS în combinație cu uree și temperatură ridicată și săruri neutre cu săruri puternice liotrope în proprietăți.

Eficacitatea tehnicii de adsorbție a anticorpului proteinei A a fost testată în comparații directe cu o metodă convențională de precipitare a anticorpului dublu pentru izolarea limfocitelor  IgM de șoarece  . Adsorbantul bacterian nu numai că a avut un avantaj distinct în ceea ce privește viteza de izolare a antigenului, dar analizele prin electroforeză pe gel de poliacrilamidă în SDS au evidențiat, de asemenea, recuperări ale antigenului mai ridicate, niveluri mai scăzute de radioactivitate de fond și absența altor   componente celulare care se pot lega nespecific și se pot complica analizele folosind precipitate imune convenționale.

Izolacja ludzkiego genu, który hamuje zakażenie HIV-1 i jest tłumiony przez wirusowe białko Vif.

Virușii au dezvoltat various strategii non-imune pentru a contracara mecanismele mediate de gazdă care conferă rezistență la infecție. Proteinele Vif (factorul de infectivitate al virionului) sunt codificate de virusurile imunodeficienței primatelor, în particular virusul imunodeficienței umane-1 (HIV-1). Aceste proteine ​​sunt regulatori puternici ai infecției și replicării virusului și, prin urmare, sunt esențiale pentru infecțiile patogene in vivo. HIV-1 Vif pare a fi necesar în timpul etapelor târzii ale producției de virus pentru suprimarea unui fenotip antiviral înnăscut care se află în limfocitele T umane  .

Astfel, în absența Vif, expresia acestui fenotip face virionii descendenți neinfecțioși. Aici, descriem o genă celulară unică, CEM15, a cărei expresie tranzitorie sau stabilă în  celule  care nu exprimă în mod regular CEM15 recreează acest fenotip , dar a cărei acțiune antivirală este depășită de prezența Vif. Deoarece circuitul de reglementare Vif: CEM15 este esențial pentru replicarea HIV-1 , perturbarea circuitului poate fi o țintă promițătoare pentru viitoarele terapii cu HIV / SIDA.



Predykcyjne korelaty odpowiedzi na przeciwciało anty-PD-L1 MPDL3280A u pacjentów z rakiem.

Dezvoltarea cancerului uman este un proces cu mai multe etape caracterizat prin acumularea de modificări genetice și epigenetice care conduc sau reflectă progresia tumorii. Aceste modificări disting celulele  canceroase  de omologii lor normali, permițând tumorilor să fie recunoscute ca străine de sistemul imunitar. Cu toate acestea, tumorile sunt rar respinse în mod spontan, reflectând capacitatea lor de a menține un microambient imunosupresor.

Ligand de moarte programat 1 (PD-L1; numit și B7-H1 sau CD274), care se exprimă pe multe celule canceroase și imune  , joacă un rol essential în blocarea „ciclului imunității cancerului” prin legarea morții programate-1 (PD- 1) și B7.1 (CD80), ambele fiind regulatori negativi ai  activării limfocitelor T. Legarea PD-L1 de receptorii săi suprimă  migrația celulelor T , proliferarea și secreția mediatorilor citotoxici și restricționează  uciderea celulelor tumorale  .

Axa PD-L1-PD-1 protejează gazda de celulele efectoare T hiperactive   nu numai în most cancers, ci și în timpul infecțiilor microbiene. Blocarea PD-L1 ar trebui, prin urmare, să sporească imunitatea împotriva cancerului, dar se știe puțin despre factorii predictivi ai eficacității. Acest studiu a fost conceput pentru a evalua siguranța, activitatea și biomarkerii inhibiției PD-L1 utilizând anticorpul umanizat proiectat MPDL3280A.

Aici arătăm că, în mai multe tipuri de most cancers, răspunsurile (astfel cum au fost consider de criteriile de evaluare a răspunsului în tumorile solide, versiunea 1.1) au fost observate la pacienții cu tumori care exprimă niveluri ridicate de PD-L1, mai ales atunci când PD-L1 a fost exprimat prin imunitatea infiltrată în tumori.  celule . Mai mult, răspunsurile au fost asociate cu expresia genei T-helper tip 1 (TH1), expresia CTLA4 și absența fractalkinei (CX3CL1) la specimenele tumorale de bază. Împreună, aceste date sugerează că MPDL3280A este cel mai eficient la pacienții la care imunitatea preexistentă este suprimată de PD-L1 și este revigorată în timpul tratamentului cu anticorpi.

Antygen CD4 (T4) jest podstawowym składnikiem receptorora retrowirusa SIDA.

Sindromul imunodeficienței dobândite (SIDA) se caracterizează prin infecții oportuniste și prin „neoplasme oportuniste” (de exemplu, sarcomul Kaposi). Limfadenopatia generalizată persistentă (PGL) este asociată epidemiologic cu SIDA, în particular la bărbații homosexuali. Un subset de limfocite T   pozitive pentru antigenul CD4 (numit și antigen T4), este epuizat la pacienții cu SIDA și PGL. Un retrovirus găsit în  culturile de celule T de la acești pacienți este puternic implicat în etiologia SIDA din cauza frecvenței ridicate de izolare și a prevalenței anticorpilor specifici la pacienți. Aici am detectat  receptori de suprafață celulară pentru retrovirusul SIDA ( celule T umane virusul leucemiei-III (HTLV-III) și izolatele virusului 1 asociate cu limfadenopatie (LAV-1) izolate) prin testarea susceptibilității  celulelor  la infecția cu pseudotipuri ale virusului stomatitei veziculare care poartă antigeni de înveliș retroviral și prin formarea de sincitii multinucleate pe amestecarea producătoare de virus  celule  cu receptor purtătoare  de celule .

Receptorii au fost prezenți numai pe  celulele care  exprimă antigen CD4; dintre cei 155 de anticorpi monoclonali testați, fiecare dintre cei 14 anticorpi anti-CD4 a inhibat formarea sincitiilor și a blocat pseudotipurile. Infecție productivă a CD4 +  celule  cu HTLV-III sau LAV-1 a redus semnificativ  de celule de expresie -suprafața de CD4. In distinction, receptorii pentru HTLV-I și HTLV-II nu au fost limitate la CD4 +  celule , nu au fost blocate de anticorpi anti-CD4; celulele  infectate productiv cu HTLV-I și HTLV-II au exprimat suprafața CD4. Prin urmare, concluzionăm că antigenul CD4 este o componentă esențială și specifică a receptorului pentru agentul cauzal al SIDA.

Komórkowe i molekularne mechanizmy zwłóknienia.

Fibroza este definită de creșterea excesivă, întărirea și / sau cicatrizarea diferitelor țesuturi și este atribuită depunerii în exces a componentelor matricei ularului cu celule suplimentare , inclusiv colagenul. Fibroza este rezultatul closing al reacțiilor inflamatorii cronice induse de o varietate de stimuli, inclusiv infecții persistente, reacții autoimune, răspunsuri alergice, insulte chimice, radiații și leziuni tisulare. Deși tratamentele actuale pentru bolile fibrotice, cum ar fi fibroza pulmonară idiopatică, ciroza hepatică, scleroza sistemică, boala progresivă a rinichilor și fibroza cardiovasculară vizează de obicei inflamațiarăspuns, se acumulează dovezi că mecanismele care conduc fibrogeneza sunt distincte de cele care reglementează inflamația. De fapt, unele studii au sugerat că este necesară inflamația continuă pentru a inversa fibroza stabilită și progresivă.

Mediul cheie al  celulelor ular al fibrozei este miofibroblastul, care atunci când este activat servește ca celulă primară producătoare de colagen  . Miofibroblastele sunt generate dintr – o varietate de surse , inclusiv mezenchimale rezidente  celule , epiteliale și endoteliale  celule  în procesele fiind denumită epiteliale / endoteliale-mezenchimale (EMT / EndMT) de tranziție, precum și de la circulant fibroblast-like  celule  numite fibrocite care sunt derivate din măduva osoasă celulele stem  .

Miofibroblastele sunt activate de o varietate de mecanisme, inclusiv semnale paracrine derivate din  limfocite și macrofage, factori autocrini secretați de miofibroblaste și tipare moleculare asociate cu agenții patogeni (PAMPS) produse de organisme patogene care interacționează cu receptorii de recunoaștere a modelelor (adică TLR) pe fibroblaste. Citokine (IL-13, IL-21, TGF-beta1), chemokine (MCP-1, MIP-1beta), factori angiogenici (VEGF), factori de creștere (PDGF), receptori activați cu proliferatorul peroxizomului (PPAR), proteine ​​de fază acută (SAP), caspazele și componentele sistemului renină-angiotensină-aldosteron (ANG II) au fost identificate ca fiind regulatori importanți ai fibrozei și sunt investigați ca potențiale ținte ale medicamentelor antifibrotice. Această revizuire explorează înțelegerea noastră actuală a  ularului celular și a mecanismelor moleculare ale fibrogenezei.

Gene Knock-Out HR Targeting Vector [MCS1-EF1a-RFP-T2A-Hygro-pA-MCS2]

HR510PA-1 10 ug
EUR 1023
  • Category: HR Donors

TARGATT? Knock-in iPSC Generation (Master Cell Line)

AST-1100 1 vial of 1X10^6 cells Ask for price
Description: 6 month

TARGATT? Knock-in Mouse Cell Line Generation Kit (Master Cell Line)

AST-7001 1 Kit Ask for price
Description: 6 month

Vpreb3 3'UTR Luciferase Stable Cell Line

TU122114 1.0 ml Ask for price

VPREB3 3'UTR GFP Stable Cell Line

TU078275 1.0 ml
EUR 1521

Vpreb3 3'UTR GFP Stable Cell Line

TU172114 1.0 ml Ask for price

Vpreb3 3'UTR Luciferase Stable Cell Line

TU223239 1.0 ml Ask for price

VPREB3 3'UTR Luciferase Stable Cell Line

TU028275 1.0 ml
EUR 1521

Vpreb3 3'UTR GFP Stable Cell Line

TU273239 1.0 ml Ask for price

HEK-293T cells

T0011002 One Frozen vial
EUR 455

TARGATT? Knock-in CHO Generation Kit (Master Cell Line)

AST-1200 1 Kit Ask for price
Description: 12 month

TARGATT? Knock-in HEK293 Generation Kit (Master Cell Line)

AST-1300 1 Kit Ask for price
Description: 12 month

HEK-293T Telomerase Over-Expressing Cell Pellet

abx069991-1Pellet 1 Pellet
EUR 398
  • Shipped within 1-3 working days.

Basic HR Targeting Vector [MCS1-LoxP-MCS2-MCS3-pA-LoxP-MCS4] for Gene Knock-In/Out

HR100PA-1 10 ug
EUR 938
  • Category: HR Donors

VPREB3 antibody

70R-21261 50 ul
EUR 435
Description: Rabbit polyclonal VPREB3 antibody

VPREB3 Antibody

43594-100ul 100ul
EUR 252

VPREB3 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VPREB3. Recognizes VPREB3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

VPREB3 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against VPREB3. Recognizes VPREB3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA18600 50 ul
EUR 363
Description: Mouse polyclonal to VPREB3


YF-PA18601 50 ug
EUR 363
Description: Mouse polyclonal to VPREB3


YF-PA26081 50 ul
EUR 334
Description: Mouse polyclonal to VPREB3

293AD Cell Line

AD-100 1 vial
EUR 461
Description: The 293AD Cell Line is derived from the parental 293 cells but selected for attributes that increase adenovirus production, including firmer attachment and larger surface area.

293AAV Cell Line

AAV-100 1 vial
EUR 508
Description: The 293AAV Cell Line is derived from the parental 293 cells but selected for attributes that increase AAV production, including firmer attachment and larger surface area.

293LTV Cell Line

LTV-100 1 vial
EUR 508
Description: The 293LTV Cell Line is derived from the parental 293 cells but selected for attributes that increase lentiviral production, including fimrer attachment and larger surface area.

293RTV Cell Line

RV-100 1 vial
EUR 508
Description: The 293RTV Cell Line is derived from the parental 293 cells but selected for attributes that increase retroviral production, including fimrer attachment and larger surface area.

VPREB3 sgRNA CRISPR Lentivector set (Human)

K2617001 3 x 1.0 ug
EUR 339


EF004206 96 Tests
EUR 689

Human VPREB3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

VPREB3 Recombinant Protein (Human)

RP034357 100 ug Ask for price

Microplate Swing-Out Centrifuge

abx725026-1Unit 1 Unit
EUR 1476
  • Shipped within 10-15 working days.

Clinical Swing-Out Centrifuge

abx725027-1Unit 1 Unit
EUR 1476
  • Shipped within 10-15 working days.

Gene Knock-Out HR Targeting Vector w/Single Selection Marker (Blasticidin) and Negative Selection (TK) Against Random Integration

HR720PA-1 10 µg
EUR 1145
  • Category: HR Donors

293T Transfection Kit (1 mL)


293T Transfection Kit (0.2 mL)


293T Transfection Kit (1 mL)


293T Transfection Kit (0.2 mL)


293/GFP Cell Line

AKR-200 1 vial
EUR 572
Description: 293/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.

T47D/GFP Cell Line

AKR-208 1 vial
EUR 572
Description: T47D/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.

A549/GFP Cell Line

AKR-209 1 vial
EUR 572
Description: A549/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.

HeLa/GFP Cell Line

AKR-213 1 vial
EUR 572
Description: HeLa/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.

NIH3T3/GFP Cell Line

AKR-214 1 vial
EUR 572
Description: NIH3T3/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.

NIH3T3/Cas9 Cell Line

AKR-5104 1 vial
EUR 572

293/Cas9 Cell Line

AKR-5110 1 vial
EUR 572

HeLa/Cas9 Cell Line

AKR-5111 1 vial
EUR 572

VPREB3 cloning plasmid

CSB-CL891724HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 372
  • Sequence: atggcctgccggtgcctcagcttccttctgatggggaccttcctgtcagtttcccagacagtcctggcccagctggatgcactgctggtcttcccaggccaagtggctcaactctcctgcacgctcagcccccagcacgtcaccatcagggactacggtgtgtcctggtaccagca
  • Show more
Description: A cloning plasmid for the VPREB3 gene.

VPREB3 Conjugated Antibody

C43594 100ul
EUR 397

VPREB3 Polyclonal Antibody

A61726 100 µg
EUR 570.55
Description: fast delivery possible

anti- VPREB3 antibody

FNab09425 100µg
EUR 585
  • Recommended dilution: WB: 1:200-1:2000
  • Immunogen: pre-B lymphocyte 3
  • Uniprot ID: Q9UKI3
  • Gene ID: 29802
  • Research Area: Immunology, stem cells
Description: Antibody raised against VPREB3

Anti-VPREB3 antibody

PAab09425 100 ug
EUR 412

Anti-VPREB3 antibody

STJ73463 100 µg
EUR 260

Anti-VPREB3 (4H8)

YF-MA18256 100 ug
EUR 363
Description: Mouse monoclonal to VPREB3

VPREB3 sgRNA CRISPR Lentivector (Human) (Target 1)

K2617002 1.0 ug DNA
EUR 154

VPREB3 sgRNA CRISPR Lentivector (Human) (Target 2)

K2617003 1.0 ug DNA
EUR 154

VPREB3 sgRNA CRISPR Lentivector (Human) (Target 3)

K2617004 1.0 ug DNA
EUR 154

Gene Knock-Out HR Targeting Vector w/Dual Selection Markers (GFP+Puro) and Negative Selection (TK) Against Random Integration

HR700PA-1 10 µg
EUR 1145
  • Category: HR Donors

Gene Knock-Out HR Targeting Vector w/Dual Selection Markers (RFP+Hygro) and Negative Selection (TK) Against Random Integration

HR710PA-1 10 µg
EUR 1145
  • Category: HR Donors

SKOV-3/Luc Cell Line

AKR-232 1 vial
EUR 572
Description: SKOV-3/Luc Cell Line stably expresses luciferase and otherwise exhibits the same characteristics of the parental cell line.

MCF-7/Luc Cell Line

AKR-234 1 vial
EUR 572
Description: MCF-7/Luc Cell Line stably expresses luciferase and otherwise exhibits the same characteristics of the parental cell line.

OVCAR-5/RFP Cell Line

AKR-254 1 vial
EUR 572
Description: OVCAR-5/RFP Cell Line stably expresses RFP and otherwise exhibits the same characteristics of the parental cell line.

VPREB3 ORF Vector (Human) (pORF)

ORF011453 1.0 ug DNA
EUR 95

Gene Knock-Out HR Targeting Vector with TK selection [MCS1-LoxP-EF1?-GFP-T2A-Puro-P2A-hsvTK-pA-LoxP-MCS2]

HR210PA-1 10 ug
EUR 1145
  • Category: HR Donors

Vpreb3 sgRNA CRISPR Lentivector set (Rat)

K6154001 3 x 1.0 ug
EUR 339

Vpreb3 sgRNA CRISPR Lentivector set (Mouse)

K3123201 3 x 1.0 ug
EUR 339

VPREB3 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VPREB3. Recognizes VPREB3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

VPREB3 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VPREB3. Recognizes VPREB3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

VPREB3 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VPREB3. Recognizes VPREB3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

VPREB3 Recombinant Protein (Rat)

RP236981 100 ug Ask for price

VPREB3 Recombinant Protein (Mouse)

RP184868 100 ug Ask for price

Platinum-E Retroviral Packaging Cell Line, Ecotropic

RV-101 1 vial
EUR 920
Description: Conventional cells used for retrovirus packaging, such as those based on NIH3T3 cells, have limited stability and produce relatively low yields of retrovirus, mainly due to the poor expression of retroviral structure proteins (gag, pol and env) in the cells. The Platinum Retroviral Packaging Cell Lines are based on the 293T cell line. They exhibit longer stability and produce higher yields of retroviral structure proteins. Plat-E cells contain gag, pol and env genes, allowing retroviral packaging with a single plasmid transfection.

Platinum-A Retroviral Packaging Cell Line, Amphotropic

RV-102 1 vial
EUR 920
Description: Conventional cells used for retrovirus packaging, such as those based on NIH3T3 cells, have limited stability and produce relatively low yields of retrovirus, mainly due to the poor expression of retroviral structure proteins (gag, pol and env) in the cells. The Platinum Retroviral Packaging Cell Lines are based on the 293T cell line. They exhibit longer stability and produce higher yields of retroviral structure proteins. Plat-A cells contain gag, pol and env genes, allowing retroviral packaging with a single plasmid transfection.

Platinum-GP Retroviral Packaging Cell Line, Pantropic

RV-103 1 vial
EUR 920
Description: Conventional cells used for retrovirus packaging, such as those based on NIH3T3 cells, have limited stability and produce relatively low yields of retrovirus, mainly due to the poor expression of retroviral structure proteins (gag, pol and env) in the cells. The Platinum Retroviral Packaging Cell Lines are based on the 293T cell line. They exhibit longer stability and produce higher yields of retroviral structure proteins. Plat-GP cells contain the gag and pol genes required for retroviral packaging; an expression vector is co-transfected with a VSVG envelope vector.

TARGATT? Knock-in iPSC Genotyping Kit

AST-1102 1 Kit Ask for price
Description: 12 month

PinPoint-FC 293T Platform Cell Line for Targeted Gene Insertion (with PinPoint site already placed)

PIN320A-1 >2x10^5 cells
EUR 3104
  • Category: PinPoint Integrase Tools

Total Protein - Murine Embryonic Stem Cell Line D3

CBA-305 500 ?g
EUR 345
  • Isolated from mouse ES-D3 cell line
  • Presented as 500 µg at 1 mg/mL in NP-40 Solubilization Buffer

Vpreb3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6154002 1.0 ug DNA
EUR 154

Vpreb3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6154003 1.0 ug DNA
EUR 154

Vpreb3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6154004 1.0 ug DNA
EUR 154

Vpreb3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3123202 1.0 ug DNA
EUR 154

Vpreb3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3123203 1.0 ug DNA
EUR 154

Vpreb3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3123204 1.0 ug DNA
EUR 154

Polyclonal VPREB3 Antibody (internal region)

APG00623G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human VPREB3 (internal region). This antibody is tested and proven to work in the following applications:

VPREB3 Polyclonal Antibody, Biotin Conjugated

A61727 100 µg
EUR 570.55
Description: reagents widely cited

VPREB3 Polyclonal Antibody, FITC Conjugated

A61728 100 µg
EUR 570.55
Description: Ask the seller for details

VPREB3 Polyclonal Antibody, HRP Conjugated

A61729 100 µg
EUR 570.55
Description: The best epigenetics products

Vpreb3 ORF Vector (Mouse) (pORF)

ORF061624 1.0 ug DNA
EUR 506

Vpreb3 ORF Vector (Rat) (pORF)

ORF078995 1.0 ug DNA
EUR 506

TARGATT? Knock-in iPSC Quick Knockin Kit

AST-1101 1 Kit Ask for price
Description: 12 month

VPREB3 Protein Vector (Human) (pPB-C-His)

PV045809 500 ng
EUR 329

VPREB3 Protein Vector (Human) (pPB-N-His)

PV045810 500 ng
EUR 329

Leave a Reply

Your email address will not be published. Required fields are marked *