srsf

Specyficzna rekrutacja regulatorowych limfocytów T w raku jajnika

0 Comments

Płynny mannequin mozaiki struktury błon komórkowych.

 Este prezentat un mannequin de mozaic fluid pentru organizarea și structura brută a proteinelor și lipidelor membranelor biologice. Modelul este în concordanță cu restricțiile impuse de termodinamică. În acest mannequin, proteinele care fac parte integrantă din membrană sunt un set eterogen de molecule globulare, fiecare dispuse într-o structură amfipatică, adică cu grupările ionice și extrem de polare care ies din membrană în faza apoasă și grupurile nepolare. în mare măsură îngropat în interiorul hidrofob al membranei. Aceste molecule globulare sunt parțial încorporate într-o matrice de fosfolipide. Cea mai mare parte a fosfolipidelor este organizată ca un strat strat discontinuu, fluid, deși o mică parte a lipidei poate interacționa în mod particular cu proteinele de membrană.

Structura mozaicului fluid este, prin urmare, în mod formal similară cu o soluție bidimensională orientată de proteine ​​integrale (sau lipoproteine) în solventul bistrat cu fosfolipide vâscoase. Sunt descrise experimente recente cu o mare varietate de tehnici și mai multe sisteme de membrană diferite, toate acestea fiind compatibile cu modelul mozaicului fluid și îi adaugă multe detalii. Prin urmare, pare adecvat să sugerăm posibile mecanisme pentru diferite funcții ale membranei și fenomene mediate de membrană în lumina modelului. Ca exemple, sunt sugerate mecanisme testabile experimental pentru   modificările suprafeței celulare în transformarea malignă și pentru efectele de cooperare prezentate în interacțiunile membranelor cu unii liganzi specifici.

Notă adăugată în dovadă: De când a fost scris acest articol, am obținut dovezi microscopice electronice (69) conform cărora situsurile de legare a concanavalinei A pe membranele fibroblastelor de șoarece transformate de virusul SV40 ( celule 3T3  ) sunt mai grupate decât siturile de pe membranele celule normale  , după cum se prezice prin ipoteza reprezentată în Fig. 7B. A apărut și un studiu realizat de Taylor și colab. (70) care arată efectele remarcabile produse asupra  limfocitelor  prin adăugarea de anticorpi direcționați către moleculele lor de imunoglobulină de suprafață.

Anticorpii induc o redistribuire și pinocitoză a acestor imunoglobuline de suprafață, astfel încât în ​​aproximativ 30 de minute la 37 de grade C imunoglobulinele de suprafață sunt complet măturate din membrană. Aceste efecte nu apar, totuși, dacă anticorpii bivalenți sunt înlocuiți cu fragmentele lor Fab univalente sau dacă experimentele de anticorpi sunt efectuate la zero grade C în loc de 37 grade C.

Aceste și rezultatele conexe indică cu tărie că anticorpii bivalenți produc o agregare a moleculelor de imunoglobulină de suprafață în planul membranei, care pot apărea numai dacă moleculele de imunoglobulină sunt libere să difuzeze în membrană . Această agregare atuncipare să declanșeze pinocitoza componentelor membranei printr-un mecanism necunoscut. Astfel de transformări de membrană pot avea o importanță crucială în inducerea unui răspuns de anticorp la un antigen, precum și iv alte procese de   diferențiere celulară .

srsf

srsf

Gene Knock-Out HR Targeting Vector [MCS1-EF1a-GFP-T2A-Puro-pA-MCS2]

HR410PA-1 10 ug
EUR 1023
  • Category: HR Donors

Gene Knock-Out HR Targeting Vector [MCS1-EF1a-RFP-T2A-Hygro-pA-MCS2]

HR510PA-1 10 ug
EUR 1023
  • Category: HR Donors

TARGATT? Knock-in iPSC Generation (Master Cell Line)

AST-1100 1 vial of 1X10^6 cells Ask for price
Description: 6 month

TARGATT? Knock-in Mouse Cell Line Generation Kit (Master Cell Line)

AST-7001 1 Kit Ask for price
Description: 6 month

HEK-293T cells

T0011002 One Frozen vial
EUR 455

TARGATT? Knock-in CHO Generation Kit (Master Cell Line)

AST-1200 1 Kit Ask for price
Description: 12 month

TARGATT? Knock-in HEK293 Generation Kit (Master Cell Line)

AST-1300 1 Kit Ask for price
Description: 12 month

HEK-293T Telomerase Over-Expressing Cell Pellet

abx069991-1Pellet 1 Pellet
EUR 398
  • Shipped within 1-3 working days.

Basic HR Targeting Vector [MCS1-LoxP-MCS2-MCS3-pA-LoxP-MCS4] for Gene Knock-In/Out

HR100PA-1 10 ug
EUR 938
  • Category: HR Donors

Lck 3'UTR Luciferase Stable Cell Line

TU110948 1.0 ml Ask for price

Lck 3'UTR GFP Stable Cell Line

TU160948 1.0 ml Ask for price

Lck 3'UTR Luciferase Stable Cell Line

TU206973 1.0 ml Ask for price

Lck 3'UTR GFP Stable Cell Line

TU256973 1.0 ml Ask for price

LCK 3'UTR GFP Stable Cell Line

TU062323 1.0 ml
EUR 1394

LCK 3'UTR Luciferase Stable Cell Line

TU012323 1.0 ml
EUR 1394

293AD Cell Line

AD-100 1 vial
EUR 461
Description: The 293AD Cell Line is derived from the parental 293 cells but selected for attributes that increase adenovirus production, including firmer attachment and larger surface area.

293AAV Cell Line

AAV-100 1 vial
EUR 508
Description: The 293AAV Cell Line is derived from the parental 293 cells but selected for attributes that increase AAV production, including firmer attachment and larger surface area.

293LTV Cell Line

LTV-100 1 vial
EUR 508
Description: The 293LTV Cell Line is derived from the parental 293 cells but selected for attributes that increase lentiviral production, including fimrer attachment and larger surface area.

293RTV Cell Line

RV-100 1 vial
EUR 508
Description: The 293RTV Cell Line is derived from the parental 293 cells but selected for attributes that increase retroviral production, including fimrer attachment and larger surface area.

Microplate Swing-Out Centrifuge

abx725026-1Unit 1 Unit
EUR 1476
  • Shipped within 10-15 working days.

Clinical Swing-Out Centrifuge

abx725027-1Unit 1 Unit
EUR 1476
  • Shipped within 10-15 working days.

Gene Knock-Out HR Targeting Vector w/Single Selection Marker (Blasticidin) and Negative Selection (TK) Against Random Integration

HR720PA-1 10 µg
EUR 1145
  • Category: HR Donors

Human Tyrosine-protein kinase Lck (LCK)

1-CSB-EP012806HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 65.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Tyrosine-protein kinase Lck(LCK) expressed in E.coli

Human Tyrosine-protein kinase Lck (LCK)

1-CSB-EP012806HUa2
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 77.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Tyrosine-protein kinase Lck(LCK) expressed in E.coli

293T Transfection Kit (1 mL)

P902 NULL
EUR 0

293T Transfection Kit (0.2 mL)

P902S NULL
EUR 0

293T Transfection Kit (1 mL)

P903 NULL
EUR 0

293T Transfection Kit (0.2 mL)

P903S NULL
EUR 0

293/GFP Cell Line

AKR-200 1 vial
EUR 572
Description: 293/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.

T47D/GFP Cell Line

AKR-208 1 vial
EUR 572
Description: T47D/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.

A549/GFP Cell Line

AKR-209 1 vial
EUR 572
Description: A549/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.

HeLa/GFP Cell Line

AKR-213 1 vial
EUR 572
Description: HeLa/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.

NIH3T3/GFP Cell Line

AKR-214 1 vial
EUR 572
Description: NIH3T3/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.

NIH3T3/Cas9 Cell Line

AKR-5104 1 vial
EUR 572

293/Cas9 Cell Line

AKR-5110 1 vial
EUR 572

HeLa/Cas9 Cell Line

AKR-5111 1 vial
EUR 572

Gene Knock-Out HR Targeting Vector w/Dual Selection Markers (GFP+Puro) and Negative Selection (TK) Against Random Integration

HR700PA-1 10 µg
EUR 1145
  • Category: HR Donors

Gene Knock-Out HR Targeting Vector w/Dual Selection Markers (RFP+Hygro) and Negative Selection (TK) Against Random Integration

HR710PA-1 10 µg
EUR 1145
  • Category: HR Donors

SKOV-3/Luc Cell Line

AKR-232 1 vial
EUR 572
Description: SKOV-3/Luc Cell Line stably expresses luciferase and otherwise exhibits the same characteristics of the parental cell line.

MCF-7/Luc Cell Line

AKR-234 1 vial
EUR 572
Description: MCF-7/Luc Cell Line stably expresses luciferase and otherwise exhibits the same characteristics of the parental cell line.

OVCAR-5/RFP Cell Line

AKR-254 1 vial
EUR 572
Description: OVCAR-5/RFP Cell Line stably expresses RFP and otherwise exhibits the same characteristics of the parental cell line.

Lck/ Rat Lck ELISA Kit

ELI-38801r 96 Tests
EUR 886

Gene Knock-Out HR Targeting Vector with TK selection [MCS1-LoxP-EF1?-GFP-T2A-Puro-P2A-hsvTK-pA-LoxP-MCS2]

HR210PA-1 10 ug
EUR 1145
  • Category: HR Donors

Human Tyrosine protein kinase Lck(LCK) ELISA kit

E01T0623-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tyrosine protein kinase Lck(LCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tyrosine protein kinase Lck(LCK) ELISA kit

E01T0623-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tyrosine protein kinase Lck(LCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tyrosine protein kinase Lck(LCK) ELISA kit

E01T0623-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tyrosine protein kinase Lck(LCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tyrosine- protein kinase Lck, LCK ELISA KIT

ELI-31641h 96 Tests
EUR 824

Monoclonal p56lck / LCK Antibody (clone Lck-01), Clone: Lck-01

APR17729G 0.05mg
EUR 484
Description: A Monoclonal antibody against Human p56lck / LCK (clone Lck-01). The antibodies are raised in Mouse and are from clone Lck-01. This antibody is applicable in WB and IHC-P, ICC, IP, Flo

LCK sgRNA CRISPR Lentivector set (Human)

K1201901 3 x 1.0 ug
EUR 339

Tyrosine-Protein Kinase Lck (LCK) Antibody

abx159593-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

Platinum-E Retroviral Packaging Cell Line, Ecotropic

RV-101 1 vial
EUR 920
Description: Conventional cells used for retrovirus packaging, such as those based on NIH3T3 cells, have limited stability and produce relatively low yields of retrovirus, mainly due to the poor expression of retroviral structure proteins (gag, pol and env) in the cells. The Platinum Retroviral Packaging Cell Lines are based on the 293T cell line. They exhibit longer stability and produce higher yields of retroviral structure proteins. Plat-E cells contain gag, pol and env genes, allowing retroviral packaging with a single plasmid transfection.

Platinum-A Retroviral Packaging Cell Line, Amphotropic

RV-102 1 vial
EUR 920
Description: Conventional cells used for retrovirus packaging, such as those based on NIH3T3 cells, have limited stability and produce relatively low yields of retrovirus, mainly due to the poor expression of retroviral structure proteins (gag, pol and env) in the cells. The Platinum Retroviral Packaging Cell Lines are based on the 293T cell line. They exhibit longer stability and produce higher yields of retroviral structure proteins. Plat-A cells contain gag, pol and env genes, allowing retroviral packaging with a single plasmid transfection.

Platinum-GP Retroviral Packaging Cell Line, Pantropic

RV-103 1 vial
EUR 920
Description: Conventional cells used for retrovirus packaging, such as those based on NIH3T3 cells, have limited stability and produce relatively low yields of retrovirus, mainly due to the poor expression of retroviral structure proteins (gag, pol and env) in the cells. The Platinum Retroviral Packaging Cell Lines are based on the 293T cell line. They exhibit longer stability and produce higher yields of retroviral structure proteins. Plat-GP cells contain the gag and pol genes required for retroviral packaging; an expression vector is co-transfected with a VSVG envelope vector.

TARGATT? Knock-in iPSC Genotyping Kit

AST-1102 1 Kit Ask for price
Description: 12 month

Lck protein

30R-2848 5 ug
EUR 503
Description: Purified recombinant Human Lck protein

Lck antibody

20R-1612 100 ug
EUR 673
Description: Rabbit polyclonal Lck antibody

Lck antibody

20R-1613 100 ug
EUR 705
Description: Rabbit polyclonal Lck antibody

LCK antibody

20R-1997 50 ug
EUR 281
Description: Rabbit polyclonal LCK antibody

LCK antibody

20R-2166 50 ug
EUR 281
Description: Rabbit polyclonal LCK antibody

LCK antibody

20R-2987 100 ul
EUR 393
Description: Rabbit polyclonal LCK antibody

LCK antibody

70R-18229 50 ul
EUR 435
Description: Rabbit polyclonal LCK antibody

Lck antibody

70R-11874 100 ug
EUR 403
Description: Rabbit polyclonal Lck antibody

LCK antibody

70R-2658 50 ug
EUR 467
Description: Rabbit polyclonal LCK antibody raised against the N terminal of LCK

Lck Antibody

3498-100
EUR 316

Lck Antibody

3498-30T
EUR 146

Lck Antibody

35363-100ul 100ul
EUR 390

Lck Antibody

35446-100ul 100ul
EUR 390

LCK Antibody

32644-100ul 100ul
EUR 252

LCK antibody

10R-2019 100 ul
EUR 435
Description: Mouse monoclonal LCK antibody

LCK antibody

10R-10823 100 ug
EUR 381
Description: Mouse monoclonal LCK antibody

LCK antibody

10R-8607 100 ul
EUR 393
Description: Mouse monoclonal LCK antibody

LCK antibody

10R-8608 100 ul
EUR 393
Description: Mouse monoclonal LCK antibody

LCK Antibody

1-CSB-PA003142
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against LCK. Recognizes LCK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

LCK Antibody

DF6900 200ul
EUR 304
Description: LCK Antibody detects endogenous levels of total LCK.

Lck, Active

7733-5
EUR 370

Lck antibody

70R-35606 100 ug
EUR 327
Description: Rabbit polyclonal Lck antibody

Lck antibody

70R-36662 100 ug
EUR 327
Description: Rabbit Polyclonal Lck antibody

LCK antibody

70R-49992 100 ul
EUR 287
Description: Purified Polyclonal LCK antibody

LCK antibody

70R-49993 100 ul
EUR 244
Description: Purified Polyclonal LCK antibody

Lck antibody

70R-34247 100 ug
EUR 327
Description: Rabbit polyclonal Lck antibody

LCK antibody

70R-34386 100 ug
EUR 327
Description: Rabbit polyclonal LCK antibody

LCK Antibody

AF5412 200ul
EUR 304
Description: LCK Antibody detects endogenous levels of total LCK.

Lck Antibody

AF6100 200ul
EUR 304
Description: Lck Antibody detects endogenous levels of total Lck.

Lck Antibody

AF6101 200ul
EUR 304
Description: Lck Antibody detects endogenous levels of total Lck.

Lck Antibody

BF0456 200ul
EUR 376
Description: Lck antibody detects endogenous levels of total Lck.

LCK Antibody

1-CSB-PA012806GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against LCK. Recognizes LCK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

LCK Antibody

1-CSB-PA012806LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LCK. Recognizes LCK from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF, IP; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200, IP:1:200-1:2000

LCK Antibody

1-CSB-PA009795
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against LCK. Recognizes LCK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

LCK Antibody

1-CSB-PA009798
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against LCK. Recognizes LCK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/40000

LCK Antibody

1-CSB-PA009802
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against LCK. Recognizes LCK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/5000

LCK siRNA

20-abx902944
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LCK siRNA

20-abx922340
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LCK siRNA

20-abx922341
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Lck Antibody

AF7694 200ul
EUR 376
Description: Lck Antibody detects endogenous levels of Lck.

Lck Antibody

AF7695 200ul
EUR 376
Description: Lck Antibody detects endogenous levels of Lck.

LCK Antibody

AF7696 200ul
EUR 376
Description: LCK Antibody detects endogenous levels of LCK.

LCK Antibody

ABF5412 100 ug
EUR 438

Lck Antibody

ABF6100 100 ug
EUR 438

Lck Antibody

ABF6101 100 ug
EUR 438

LCK Antibody

ABD6900 100 ug
EUR 438

Lck Inhibitor

A3539-1 1 mg
EUR 154
Description: Lck Inhibitor is a small-molecule inhibitor of with IC50 value of 7 nM [1].The lymphocyte specific kinase which expressed in NK cells and T-cells is a member of the Src kinase family.

Lck Inhibitor

A3539-5 5 mg
EUR 222
Description: Lck Inhibitor is a small-molecule inhibitor of with IC50 value of 7 nM [1].The lymphocyte specific kinase which expressed in NK cells and T-cells is a member of the Src kinase family.

Lck Inhibitor

HY-12072 100mg
EUR 2019

anti-LCK

LF-PA0206 100 ul
EUR 334
Description: Rabbit polyclonal to LCK

anti-Lck

YF-PA12927 100 ug
EUR 403
Description: Rabbit polyclonal to Lck

Lck Colorimetric Cell-Based ELISA Kit

EKC1338 100ul
EUR 572

PinPoint-FC 293T Platform Cell Line for Targeted Gene Insertion (with PinPoint site already placed)

PIN320A-1 >2x10^5 cells
EUR 3104
  • Category: PinPoint Integrase Tools

LCK ELISA KIT|Human

EF010640 96 Tests
EUR 689

Human LCK shRNA Plasmid

20-abx952664
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Total Protein - Murine Embryonic Stem Cell Line D3

CBA-305 500 ?g
EUR 345
Description:
  • Isolated from mouse ES-D3 cell line
  • Presented as 500 µg at 1 mg/mL in NP-40 Solubilization Buffer

LCK sgRNA CRISPR Lentivector (Human) (Target 1)

K1201902 1.0 ug DNA
EUR 154

LCK sgRNA CRISPR Lentivector (Human) (Target 2)

K1201903 1.0 ug DNA
EUR 154

LCK sgRNA CRISPR Lentivector (Human) (Target 3)

K1201904 1.0 ug DNA
EUR 154

Human Proto-Oncogene Tyrosine-Protein Kinase LCK (LCK) ELISA Kit

abx388241-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

TARGATT? Knock-in iPSC Quick Knockin Kit

AST-1101 1 Kit Ask for price
Description: 12 month

Rat Tyrosine protein kinase Lck(LCK) ELISA kit

E02T0623-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Tyrosine protein kinase Lck(LCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Tyrosine protein kinase Lck(LCK) ELISA kit

E02T0623-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Tyrosine protein kinase Lck(LCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Tyrosine protein kinase Lck(LCK) ELISA kit

E02T0623-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Tyrosine protein kinase Lck(LCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Tyrosine protein kinase Lck(LCK) ELISA kit

E04T0623-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Tyrosine protein kinase Lck(LCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Tyrosine protein kinase Lck(LCK) ELISA kit

E04T0623-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Tyrosine protein kinase Lck(LCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Sierocy receptor jądrowy RORgammat kieruje programem różnicowania prozapalnych komórek pomocniczych IL-17 + T.

IL-17-T producătoare  de limfocite  au fost current dovedit a cuprinde o descendență distinctă de T helper proinflamatorii  celule , numite Th17  celule , care sunt o contributie majora la boli autoimune. Arătăm aici că receptorul nuclear orfan RORgammat este factorul cheie de transcripție care orchestrează diferențierea acestei  linii de celule efectoare  . RORgammat induce transcripția genelor care codifică IL-17 și IL-citokina înrudit 17F în naivi CD4 (+) T helper  celule  și este necesar pentru exprimarea lor ca răspuns la IL-6 și TGF-beta, citokinele cunoscute de a induce IL- 17.

Celulele Th17   sunt prezente în mod constitutiv în toată lamina propria intestinală, exprimă RORgammat și sunt absente la șoareci cu deficit de RORgammat sau IL-6. Șoarecii cu celule T cu deficit de RORgammat   au boli autoimune atenuate și nu au celule Th17 care se infiltrează în țesuturi  . Împreună, aceste studii sugerează că RORgammat este un regulator cheie al homeostaziei imune și evidențiază potențialul său ca țintă terapeutică în bolile inflamatorii.

Specyficzna rekrutacja regulatorowych limfocytów T w raku jajnika sprzyja przywilejowi immunologicznemu i pozwala przewidzieć skrócenie czasu przeżycia.

 

T de reglementare (T (REG))  Celulele  mediază toleranță periferică homeostatic prin suprimarea T autoreactive  celule . Nerespectarea imunității antitumorale gazdă poate fi cauzată de supresia exagerată antigen reactive asociate tumorii  limfocite  mediate de T (REG)  celule ; Cu toate acestea, dovezi definitive care (REG) T  celule  au un rol imunopatologice in cancerul uman este lipsit. Aici ne arată, în studii detaliate ale CD4 (+) CD25 (+) FOXP3 (+) T (REG)  celule  in 104 persoane afectate cu carcinom ovarian, tumoarea umană T (REG)  celule  suprima T-tumorale specifice  celulei  imunitate și contribuie la creșterea tumorilor umane in vivo.

De asemenea, arătăm că celulele T (reg)  tumorale  sunt asociate cu un risc crescut de deces și supraviețuire redusă. Celulele T (reg)  umane  se deplasează și se acumulează preferențial în tumori și ascită, dar rareori intră în ganglionii limfatici care drenează în stadiile ulterioare ale cancerului.

Celulele tumorale   și macrofagele microambientale produc chemokina CCL22, care mediază traficul de celule T (reg)   către tumoră. Această recrutare specifică a celulelor T (reg)   reprezintă un mecanism prin care tumorile pot favoriza privilegiul imunitar. Astfel, blocarea  migrației sau funcției celulelor T (reg)  poate ajuta la înfrângerea cancerului uman.

Przywracanie funkcji wyczerpanych limfocytów T CD8 podczas przewlekłej infekcji wirusowej

Afectarea funcțională a celulelor T specifice antigenului   este o caracteristică definitorie a multor infecții cronice, dar mecanismele de bază ale  disfuncției celulelor T nu sunt bine înțelese. Pentru a rezolva această problemă, am analizat genele exprimate in afectarea useful virus-specific T CD8  celule  prezente la șoarecii infectați cronic cu virusul coriomeningitei limfocitare (LCMV) și a comparat aceste cu profilul genetic al T CD8 memorie functionale  celule .

Aici raportăm că PD-1 (moartea programată 1; cunoscut și sub numele de Pdcd1) a fost selectiv reglat în sus de celulele T epuizate și că administrarea in vivo a anticorpilor care a blocat interacțiunea acestui receptor inhibitor cu ligandul său, PD-L1 (cunoscut și ca B7-H1), a îmbunătățit  răspunsurile celulelor T.

In particular, am constatat ca , chiar si la soareci persistent infectate care au fost lipsite de celule CD4 T de celule de  ajutor, blocarea PD-1 / PD-L1 cale de inhibare a avut un efect benefic asupra „neajutorat“ T CD8  celule , restabilind capacitatea lor de a suferi proliferare , secretă citokine, ucid celulele infectate   și scad încărcătura virală. Blocarea căii inhibitoare a CTLA-4 ( proteina Four asociată cu limfocitele T citotoxice ) nu a avut niciun efect nici asupra  funcției celulelor T , nici asupra controlului viral. Aceste studii identifică un mecanism particular de  epuizare a celulelor T și definesc o strategie imunologică potențial eficientă pentru tratamentul infecțiilor virale cronice.

Human Granzyme A (GZMA) ELISA Kit

RD-GZMA-Hu-48Tests 48 Tests
EUR 478

Human Granzyme A (GZMA) ELISA Kit

RD-GZMA-Hu-96Tests 96 Tests
EUR 662

Human 293T Whole Cell Lysate

LYSATE0032 200ug
EUR 150
Description: This cell lysate is prepared from human 293T using Boster's RIPA Lysis Buffer (AR0105) using a standard whole cell lysate protocol. The concentration was determined using the BCA assay process and then diluted using Dithiothreitol (DTT) and a reducing SDS sample loading buffer, heated for 5 minutes at 100˚C.

Mouse Granzyme A (GZMA) ELISA Kit

DLR-GZMA-Mu-48T 48T
EUR 489
  • Should the Mouse Granzyme A (GZMA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Granzyme A (GZMA) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Mouse Granzyme A (GZMA) ELISA Kit

DLR-GZMA-Mu-96T 96T
EUR 635
  • Should the Mouse Granzyme A (GZMA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Granzyme A (GZMA) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Mouse Granzyme A (GZMA) ELISA Kit

RDR-GZMA-Mu-48Tests 48 Tests
EUR 511

Mouse Granzyme A (GZMA) ELISA Kit

RDR-GZMA-Mu-96Tests 96 Tests
EUR 709

Mouse Granzyme A (GZMA) ELISA Kit

RD-GZMA-Mu-48Tests 48 Tests
EUR 489

Mouse Granzyme A (GZMA) ELISA Kit

RD-GZMA-Mu-96Tests 96 Tests
EUR 677

AAVS1 Positive Control EGIP 293T Reporter Cell Line

CAS606A-1 1 Vial
EUR 807
  • Category: Cas9

Gene Knock-Out HR Targeting Vector [MCS1-EF1?-RFP-T2A-Puro-pA-MCS2]

HR110PA-1 10 ug
EUR 1023
  • Category: HR Donors

Gene Knock-Out HR Targeting Vector [MCS1-EF1a-GFP-T2A-Puro-pA-MCS2]

HR410PA-1 10 ug
EUR 1023
  • Category: HR Donors

Gene Knock-Out HR Targeting Vector [MCS1-EF1a-RFP-T2A-Hygro-pA-MCS2]

HR510PA-1 10 ug
EUR 1023
  • Category: HR Donors

TARGATT? Knock-in iPSC Generation (Master Cell Line)

AST-1100 1 vial of 1X10^6 cells Ask for price
Description: 6 month

TARGATT? Knock-in Mouse Cell Line Generation Kit (Master Cell Line)

AST-7001 1 Kit Ask for price
Description: 6 month

HEK-293T cells

T0011002 One Frozen vial
EUR 455

TARGATT? Knock-in CHO Generation Kit (Master Cell Line)

AST-1200 1 Kit Ask for price
Description: 12 month

TARGATT? Knock-in HEK293 Generation Kit (Master Cell Line)

AST-1300 1 Kit Ask for price
Description: 12 month

Gzma 3'UTR Luciferase Stable Cell Line

TU109260 1.0 ml Ask for price

Gzma 3'UTR Luciferase Stable Cell Line

TU205597 1.0 ml Ask for price

Gzma 3'UTR GFP Stable Cell Line

TU159260 1.0 ml Ask for price

Gzma 3'UTR GFP Stable Cell Line

TU255597 1.0 ml Ask for price

GZMA 3'UTR GFP Stable Cell Line

TU059495 1.0 ml
EUR 1394

GZMA 3'UTR Luciferase Stable Cell Line

TU009495 1.0 ml
EUR 1394

HEK-293T Telomerase Over-Expressing Cell Pellet

abx069991-1Pellet 1 Pellet
EUR 398
  • Shipped within 1-3 working days.

Basic HR Targeting Vector [MCS1-LoxP-MCS2-MCS3-pA-LoxP-MCS4] for Gene Knock-In/Out

HR100PA-1 10 ug
EUR 938
  • Category: HR Donors

293AD Cell Line

AD-100 1 vial
EUR 461
Description: The 293AD Cell Line is derived from the parental 293 cells but selected for attributes that increase adenovirus production, including firmer attachment and larger surface area.

293AAV Cell Line

AAV-100 1 vial
EUR 508
Description: The 293AAV Cell Line is derived from the parental 293 cells but selected for attributes that increase AAV production, including firmer attachment and larger surface area.

293LTV Cell Line

LTV-100 1 vial
EUR 508
Description: The 293LTV Cell Line is derived from the parental 293 cells but selected for attributes that increase lentiviral production, including fimrer attachment and larger surface area.

293RTV Cell Line

RV-100 1 vial
EUR 508
Description: The 293RTV Cell Line is derived from the parental 293 cells but selected for attributes that increase retroviral production, including fimrer attachment and larger surface area.

Microplate Swing-Out Centrifuge

abx725026-1Unit 1 Unit
EUR 1476
  • Shipped within 10-15 working days.

Clinical Swing-Out Centrifuge

abx725027-1Unit 1 Unit
EUR 1476
  • Shipped within 10-15 working days.

Gene Knock-Out HR Targeting Vector w/Single Selection Marker (Blasticidin) and Negative Selection (TK) Against Random Integration

HR720PA-1 10 µg
EUR 1145
  • Category: HR Donors

293T Transfection Kit (1 mL)

P902 NULL
EUR 0

293T Transfection Kit (0.2 mL)

P902S NULL
EUR 0

293T Transfection Kit (1 mL)

P903 NULL
EUR 0

293T Transfection Kit (0.2 mL)

P903S NULL
EUR 0

293/GFP Cell Line

AKR-200 1 vial
EUR 572
Description: 293/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.

T47D/GFP Cell Line

AKR-208 1 vial
EUR 572
Description: T47D/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.

A549/GFP Cell Line

AKR-209 1 vial
EUR 572
Description: A549/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.

HeLa/GFP Cell Line

AKR-213 1 vial
EUR 572
Description: HeLa/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.

NIH3T3/GFP Cell Line

AKR-214 1 vial
EUR 572
Description: NIH3T3/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.

NIH3T3/Cas9 Cell Line

AKR-5104 1 vial
EUR 572

293/Cas9 Cell Line

AKR-5110 1 vial
EUR 572

HeLa/Cas9 Cell Line

AKR-5111 1 vial
EUR 572

GZMA antibody

70R-17667 50 ul
EUR 435
Description: Rabbit polyclonal GZMA antibody

GZMA Antibody

DF9054 200ul
EUR 304
Description: GZMA Antibody detects endogenous levels of total GZMA.

GZMA antibody

70R-9289 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal GZMA antibody

GZMA Antibody

1-CSB-PA009084
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GZMA. Recognizes GZMA from Human. This antibody is Unconjugated. Tested in the following application: IHC, IF, ELISA;IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

GZMA Antibody

1-CSB-PA010081ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GZMA. Recognizes GZMA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

GZMA Antibody

1-CSB-PA010081GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GZMA. Recognizes GZMA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Gzma Antibody

1-CSB-PA010081LA01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Gzma. Recognizes Gzma from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

GZMA siRNA

20-abx918982
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GZMA siRNA

20-abx918983
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GZMA Antibody

ABD9054 100 ug
EUR 438

Gene Knock-Out HR Targeting Vector w/Dual Selection Markers (GFP+Puro) and Negative Selection (TK) Against Random Integration

HR700PA-1 10 µg
EUR 1145
  • Category: HR Donors

Gene Knock-Out HR Targeting Vector w/Dual Selection Markers (RFP+Hygro) and Negative Selection (TK) Against Random Integration

HR710PA-1 10 µg
EUR 1145
  • Category: HR Donors

GZMA sgRNA CRISPR Lentivector set (Human)

K0923801 3 x 1.0 ug
EUR 339

SKOV-3/Luc Cell Line

AKR-232 1 vial
EUR 572
Description: SKOV-3/Luc Cell Line stably expresses luciferase and otherwise exhibits the same characteristics of the parental cell line.

MCF-7/Luc Cell Line

AKR-234 1 vial
EUR 572
Description: MCF-7/Luc Cell Line stably expresses luciferase and otherwise exhibits the same characteristics of the parental cell line.

OVCAR-5/RFP Cell Line

AKR-254 1 vial
EUR 572
Description: OVCAR-5/RFP Cell Line stably expresses RFP and otherwise exhibits the same characteristics of the parental cell line.

Human GZMA ELISA Kit

ELA-E0599h 96 Tests
EUR 824

GZMA ELISA KIT|Human

EF000669 96 Tests
EUR 689

Human GZMA shRNA Plasmid

20-abx952036
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GZMA Recombinant Protein (Human)

RP014302 100 ug Ask for price

Gene Knock-Out HR Targeting Vector with TK selection [MCS1-LoxP-EF1?-GFP-T2A-Puro-P2A-hsvTK-pA-LoxP-MCS2]

HR210PA-1 10 ug
EUR 1145
  • Category: HR Donors

GZMA sgRNA CRISPR Lentivector (Human) (Target 1)

K0923802 1.0 ug DNA
EUR 154

GZMA sgRNA CRISPR Lentivector (Human) (Target 2)

K0923803 1.0 ug DNA
EUR 154

GZMA sgRNA CRISPR Lentivector (Human) (Target 3)

K0923804 1.0 ug DNA
EUR 154

Platinum-E Retroviral Packaging Cell Line, Ecotropic

RV-101 1 vial
EUR 920
Description: Conventional cells used for retrovirus packaging, such as those based on NIH3T3 cells, have limited stability and produce relatively low yields of retrovirus, mainly due to the poor expression of retroviral structure proteins (gag, pol and env) in the cells. The Platinum Retroviral Packaging Cell Lines are based on the 293T cell line. They exhibit longer stability and produce higher yields of retroviral structure proteins. Plat-E cells contain gag, pol and env genes, allowing retroviral packaging with a single plasmid transfection.

Platinum-A Retroviral Packaging Cell Line, Amphotropic

RV-102 1 vial
EUR 920
Description: Conventional cells used for retrovirus packaging, such as those based on NIH3T3 cells, have limited stability and produce relatively low yields of retrovirus, mainly due to the poor expression of retroviral structure proteins (gag, pol and env) in the cells. The Platinum Retroviral Packaging Cell Lines are based on the 293T cell line. They exhibit longer stability and produce higher yields of retroviral structure proteins. Plat-A cells contain gag, pol and env genes, allowing retroviral packaging with a single plasmid transfection.

Platinum-GP Retroviral Packaging Cell Line, Pantropic

RV-103 1 vial
EUR 920
Description: Conventional cells used for retrovirus packaging, such as those based on NIH3T3 cells, have limited stability and produce relatively low yields of retrovirus, mainly due to the poor expression of retroviral structure proteins (gag, pol and env) in the cells. The Platinum Retroviral Packaging Cell Lines are based on the 293T cell line. They exhibit longer stability and produce higher yields of retroviral structure proteins. Plat-GP cells contain the gag and pol genes required for retroviral packaging; an expression vector is co-transfected with a VSVG envelope vector.

GZMA Blocking Peptide

33R-5360 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GZMA antibody, catalog no. 70R-9289

GZMA Polyclonal Antibody

42195-100ul 100ul
EUR 333

GZMA Blocking Peptide

DF9054-BP 1mg
EUR 195

GZMA cloning plasmid

CSB-CL010081HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 789
  • Sequence: atgaggaactcctatagatttctggcatcctctctctcagttgtcgtttctctcctgctaattcctgaagatgtctgtgaaaaaattattggaggaaatgaagtaactcctcattcaagaccctacatggtcctacttagtcttgacagaaaaaccatctgtgctggggctttgat
  • Show more
Description: A cloning plasmid for the GZMA gene.

Gzma Polyclonal Antibody

A59334 100 µg
EUR 570.55
Description: kits suitable for this type of research

GZMA Rabbit pAb

A6231-100ul 100 ul
EUR 308

GZMA Rabbit pAb

A6231-200ul 200 ul
EUR 459

GZMA Rabbit pAb

A6231-20ul 20 ul
EUR 183

GZMA Rabbit pAb

A6231-50ul 50 ul
EUR 223

Anti-GZMA antibody

STJ27987 100 µl
EUR 277
Description: Cytolytic T lymphocytes (CTL) and natural killer (NK) cells share the remarkable ability to recognize, bind, and lyse specific target cells. They are thought to protect their host by lysing cells bearing on their surface 'nonself' antigens, usually peptides or proteins resulting from infection by intracellular pathogens. The protein described here is a T cell- and natural killer cell-specific serine protease that may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells.

Anti-GZMA antibody

STJ71899 100 µg
EUR 260

Anti-GZMA (4C6)

YF-MA20335 100 ug
EUR 363
Description: Mouse monoclonal to GZMA

TARGATT? Knock-in iPSC Genotyping Kit

AST-1102 1 Kit Ask for price
Description: 12 month

Human Granzyme A (GZMA) Protein

20-abx653630
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Granzyme A (GZMA) Protein

20-abx653632
  • EUR 885.00
  • EUR 328.00
  • EUR 2834.00
  • EUR 1052.00
  • EUR 606.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Granzyme A (GZMA) Protein

20-abx651491
  • EUR 732.00
  • EUR 286.00
  • EUR 2305.00
  • EUR 885.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

GZMA ORF Vector (Human) (pORF)

ORF004768 1.0 ug DNA
EUR 95

GZMA ELISA Kit (Human) (OKAN05337)

OKAN05337 96 Wells
EUR 792
Description: Description of target: Cytolytic T lymphocytes (CTL) and natural killer (NK) cells share the remarkable ability to recognize, bind, and lyse specific target cells. They are thought to protect their host by lysing cells bearing on their surface 'nonself' antigens, usually peptides or proteins resulting from infection by intracellular pathogens. The protein described here is a T cell- and natural killer cell-specific serine protease that may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.055 ng/mL

GZMA ELISA Kit (Human) (OKBB00906)

OKBB00906 96 Wells
EUR 505
Description: Description of target: Granzyme A is a protein that in humans is encoded by the GZMA gene. Cytolytic T lymphocytes (CTL) and natural killer (NK) cells share the remarkable ability to recognize, bind, and lyse specific target cells. They are thought to protect their host by lysing cells bearing on their surface "nonself" antigens, usually peptides or proteins resulting from infection by intracellular pathogens. The protein described here is a T cell- and natural killer cell-specific serine protease that may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells. GZMA induces caspase-independent apoptosis in a characteristic manner, except it causes a distinctive form of DNA damage: single-stranded DNA nicking. A target of GZMA is the SET complex, including HMGB2 and ANP32A.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

GZMA ELISA Kit (Human) (OKCD05260)

OKCD05260 96 Wells
EUR 975
Description: Description of target: Cytolytic T lymphocytes (CTL) and natural killer (NK) cells share the remarkable ability to recognize, bind, and lyse specific target cells. They are thought to protect their host by lysing cells bearing on their surface 'nonself' antigens, usually peptides or proteins resulting from infection by intracellular pathogens. The protein described here is a T cell- and natural killer cell-specific serine protease that may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells. Cytolytic T lymphocytes (CTL) and natural killer (NK) cells share the remarkable ability to recognize, bind, and lyse specific target cells. They are thought to protect their host by lysing cells bearing on their surface 'nonself' antigens, usually peptides or proteins resulting from infection by intracellular pathogens. The protein described here is a T cell- and natural killer cell-specific serine protease that may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Entrez Gene record to access additional publications.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 5.7pg/mL

GZMA ELISA Kit (Human) (OKCD06562)

OKCD06562 96 Wells
EUR 753
Description: Description of target: Cytolytic T lymphocytes (CTL) and natural killer (NK) cells share the remarkable ability to recognize, bind, and lyse specific target cells. They are thought to protect their host by lysing cells bearing on their surface 'nonself' antigens, usually peptides or proteins resulting from infection by intracellular pathogens. The protein described here is a T cell- and natural killer cell-specific serine protease that may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells. Cytolytic T lymphocytes (CTL) and natural killer (NK) cells share the remarkable ability to recognize, bind, and lyse specific target cells. They are thought to protect their host by lysing cells bearing on their surface 'nonself' antigens, usually peptides or proteins resulting from infection by intracellular pathogens. The protein described here is a T cell- and natural killer cell-specific serine protease that may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Entrez Gene record to access additional publications.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.055ng/mL

PinPoint-FC 293T Platform Cell Line for Targeted Gene Insertion (with PinPoint site already placed)

PIN320A-1 >2x10^5 cells
EUR 3104
  • Category: PinPoint Integrase Tools

Total Protein - Murine Embryonic Stem Cell Line D3

CBA-305 500 ?g
EUR 345
Description:
  • Isolated from mouse ES-D3 cell line
  • Presented as 500 µg at 1 mg/mL in NP-40 Solubilization Buffer

Gzma sgRNA CRISPR Lentivector set (Rat)

K7364801 3 x 1.0 ug
EUR 339

Gzma sgRNA CRISPR Lentivector set (Mouse)

K3890501 3 x 1.0 ug
EUR 339

TARGATT? Knock-in iPSC Quick Knockin Kit

AST-1101 1 Kit Ask for price
Description: 12 month

Mouse Granzyme A (Gzma)

1-CSB-EP010081MO
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 39.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Granzyme A(Gzma) expressed in E.coli

Mouse Granzyme A (Gzma)

1-CSB-EP010081MOa0
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 31.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Granzyme A(Gzma) expressed in E.coli

Granzyme A (GZMA) Antibody

20-abx006330
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Granzyme A (GZMA) Antibody

20-abx176698
  • EUR 398.00
  • EUR 133.00
  • EUR 1094.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Granzyme A (GZMA) Antibody

20-abx176699
  • EUR 398.00
  • EUR 133.00
  • EUR 1094.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Granzyme A (GZMA) Antibody

20-abx176701
  • EUR 1135.00
  • EUR 551.00
  • 1 mg
  • 200 ug
  • Please enquire.

Granzyme A (GZMA) Antibody

20-abx100560
  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Granzyme A (GZMA) Antibody

20-abx112843
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Granzyme A (GZMA) Antibody

abx122954-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Granzyme A (GZMA) Antibody

20-abx128528
  • EUR 398.00
  • EUR 133.00
  • EUR 1094.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

GZMA Polyclonal Conjugated Antibody

C42195 100ul
EUR 397

Gzma Antibody, HRP conjugated

1-CSB-PA010081LB01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Gzma. Recognizes Gzma from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA

Gzma Antibody, FITC conjugated

1-CSB-PA010081LC01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Gzma. Recognizes Gzma from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA

Gzma Antibody, Biotin conjugated

1-CSB-PA010081LD01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Gzma. Recognizes Gzma from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA

Granzyme A (Gzma) Antibody

20-abx319042
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Granzyme A (GZMA) Antibody

20-abx320202
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Granzyme A (GZMA) Antibody

abx233633-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Granzyme A (GZMA) Antibody

20-abx323175
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Granzyme A (GZMA) Antibody

abx432781-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

Mouse GZMA shRNA Plasmid

20-abx970717
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Eukaryotic Granzyme A (GZMA)

4-EPA599Hu51
  • EUR 530.08
  • EUR 245.00
  • EUR 1712.80
  • EUR 637.60
  • EUR 1175.20
  • EUR 418.00
  • EUR 4132.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P12544
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 28.2kDa
  • Isoelectric Point: 9.2
Description: Recombinant Human Granzyme A expressed in: Yeast

Recombinant Granzyme A (GZMA)

4-RPA599Mu01
  • EUR 548.00
  • EUR 250.00
  • EUR 1780.00
  • EUR 660.00
  • EUR 1220.00
  • EUR 430.00
  • EUR 4300.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P11032
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 26.9kDa
  • Isoelectric Point: 9.4
Description: Recombinant Mouse Granzyme A expressed in: E.coli

GZMA Recombinant Protein (Rat)

RP204086 100 ug Ask for price

GZMA Recombinant Protein (Mouse)

RP140609 100 ug Ask for price

Human Granzyme A (GZMA) ELISA Kit

20-abx151729
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Granzyme A (GZMA) ELISA Kit

abx253929-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human GZMA/ Granzyme A ELISA Kit

E1079Hu 1 Kit
EUR 571

Human GZMA(Granzyme A) ELISA Kit

EH0974 96T
EUR 524.1
  • Detection range: 15.625-1000 pg/ml
  • Uniprot ID: P12544
  • Alias: GZMA(Granzyme A)/CTL Tryptase/CTLA3/Fragmentin-1/HF/HFSP/Cytotoxic T-lymphocyte proteinase 1/Granzyme-1/H factor/Hanukkah factor
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml

Human Granzyme A, GZMA ELISA KIT

ELI-02157h 96 Tests
EUR 824

Human granzyme A (GZMA) ELISA Kit

CSB-E08715h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human granzyme A (GZMA) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human granzyme A (GZMA) ELISA Kit

1-CSB-E08715h
  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human granzyme A (GZMA) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Granzyme A (GZMA) ELISA Kit

abx571746-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human Granzyme A (GZMA) Protein (Active)

20-abx655652
  • EUR 1191.00
  • EUR 425.00
  • EUR 4017.00
  • EUR 1455.00
  • EUR 815.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Granzyme A (GZMA) ELISA Kit

20-abx585052
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Granzyme A (GZMA) CLIA Kit

20-abx491735
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Granzyme A (GZMA) CLIA Kit

20-abx496426
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Granzyme A ELISA Kit (GZMA)

RK01528 96 Tests
EUR 521

Human Granzyme A (GZMA) ELISA Kit

SEA599Hu-10x96wellstestplate 10x96-wells test plate
EUR 4273.35
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme A (GZMA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme A (GZMA) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Granzyme A (GZMA) ELISA Kit

SEA599Hu-1x48wellstestplate 1x48-wells test plate
EUR 439.57
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme A (GZMA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme A (GZMA) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Granzyme A (GZMA) ELISA Kit

SEA599Hu-1x96wellstestplate 1x96-wells test plate
EUR 585.1
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme A (GZMA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme A (GZMA) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Granzyme A (GZMA) ELISA Kit

SEA599Hu-5x96wellstestplate 5x96-wells test plate
EUR 2332.95
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme A (GZMA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme A (GZMA) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Granzyme A (GZMA) ELISA Kit

4-SEA599Hu
  • EUR 4324.00
  • EUR 2283.00
  • EUR 586.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Granzyme A elisa. Alternative names of the recognized antigen: CTLA3
  • HFSP
  • HF
  • H factor
  • Granzyme 1
  • Fragmentin-1
  • Hanukkah factor
  • Cytotoxic T-Lymphocyte-Associated Serine Esterase 3
  • CTL tryptase
  • Cytotoxic T-lymphocyte proteinase 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Granzyme A (GZMA) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

HBS w/out Phenol Red, 500 ml

409 500 ml
EUR 72

Out At First Protein Homolog (OAF) Antibody

abx027798-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Out At First Protein Homolog (OAF) Antibody

abx027798-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Out At First Protein Homolog (OAF) Antibody

abx146027-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Gzma sgRNA CRISPR Lentivector (Rat) (Target 1)

K7364802 1.0 ug DNA
EUR 154

Gzma sgRNA CRISPR Lentivector (Rat) (Target 2)

K7364803 1.0 ug DNA
EUR 154

Gzma sgRNA CRISPR Lentivector (Rat) (Target 3)

K7364804 1.0 ug DNA
EUR 154

Gzma sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3890502 1.0 ug DNA
EUR 154

Gzma sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3890503 1.0 ug DNA
EUR 154

Gzma sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3890504 1.0 ug DNA
EUR 154

ELISA kit for Human GzmA (Granzyme A)

E-EL-H1616 1 plate of 96 wells
EUR 534
  • Gentaur's GzmA ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human GzmA. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human GzmA (Granzyme A) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human GZMA (Granzyme A)

ELK4608 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Granzyme A (GZMA). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Granzyme A (GZMA
  • Show more
Description: A sandwich ELISA kit for detection of Granzyme A from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Granzyme A (GZMA) Polyclonal Antibody (Human, Mouse)

4-PAA599Mu01
  • EUR 236.00
  • EUR 2338.00
  • EUR 586.00
  • EUR 294.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GZMA (Ile29~Val260)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Granzyme A (GZMA)

GZMA Protein Vector (Human) (pPB-C-His)

PV019069 500 ng
EUR 329

GZMA Protein Vector (Human) (pPB-N-His)

PV019070 500 ng
EUR 329

GZMA Protein Vector (Human) (pPM-C-HA)

PV019071 500 ng
EUR 329

GZMA Protein Vector (Human) (pPM-C-His)

PV019072 500 ng
EUR 329

GZMA ELISA Kit (Human) : 96 Wells (OKEH02762)

OKEH02762 96 Wells
EUR 662
Description: Description of target: Cytolytic T lymphocytes (CTL) and natural killer (NK) cells share the remarkable ability to recognize, bind, and lyse specific target cells. They are thought to protect their host by lysing cells bearing on their surface 'nonself' antigens, usually peptides or proteins resulting from infection by intracellular pathogens. The protein described here is a T cell- and natural killer cell-specific serine protease that may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.1 ng/mL

Polyclonal GZMA Antibody (internal region)

APG00588G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human GZMA (internal region). This antibody is tested and proven to work in the following applications:

Granzyme A (GZMA) Antibody (APC)

20-abx176700
  • EUR 1094.00
  • EUR 537.00
  • 1 mg
  • 200 ug
  • Please enquire.

Mouse Granzyme A (GZMA) Protein

20-abx167506
  • EUR 759.00
  • EUR 300.00
  • EUR 2388.00
  • EUR 913.00
  • EUR 537.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Granzyme A (GZMA) Antibody (Biotin)

20-abx270997
  • EUR 425.00
  • EUR 230.00
  • EUR 1219.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Granzyme A (Gzma) Antibody (HRP)

20-abx319043
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Granzyme A (Gzma) Antibody (FITC)

20-abx319044
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Granzyme A (Gzma) Antibody (Biotin)

20-abx319045
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Granzyme A (GZMA) Antibody Pair

20-abx370633
  • EUR 1595.00
  • EUR 1024.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.

Gzma Polyclonal Antibody, Biotin Conjugated

A59335 100 µg
EUR 570.55
Description: fast delivery possible

Gzma Polyclonal Antibody, FITC Conjugated

A59336 100 µg
EUR 570.55
Description: reagents widely cited

Gzma Polyclonal Antibody, HRP Conjugated

A59337 100 µg
EUR 570.55
Description: Ask the seller for details

Anti-Granzyme A/GZMA Antibody

PA1588 100ug/vial
EUR 334

Gzma ORF Vector (Rat) (pORF)

ORF068030 1.0 ug DNA
EUR 506

Gzma ORF Vector (Mouse) (pORF)

ORF046871 1.0 ug DNA
EUR 506

GZMA ELISA Kit (Mouse) (OKCD02583)

OKCD02583 96 Wells
EUR 779
Description: Description of target: Abundant protease in the cytosolic granules of cytotoxic T-cells and NK-cells which activates caspase-independent cell death with morphological features of apoptosis when delivered into the target cell through the immunological synapse. It cleaves after Lys or Arg. Cleaves APEX1 after 'Lys-31' and destroys its oxidative repair activity. Cleaves the nucleosome assembly protein SET after 'Lys-189', which disrupts its nucleosome assembly activity and allows the SET complex to translocate into the nucleus to nick and degrade the DNA. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 35 pg/mL

GZMA ELISA Kit (Bovine) (OKEH06598)

OKEH06598 96 Wells
EUR 779
Description: Description of target: Abundant protease in the cytosolic granules of cytotoxic T-cells and NK-cells which activates caspase-independent cell death with morphological features of apoptosis when delivered into the target cell through the immunological synapse. It cleaves after Lys or Arg. Cleaves APEX1 after 'Lys-31' and destroys its oxidative repair activity. Cleaves the nucleosome assembly protein SET after 'Lys-189', which disrupts its nucleosome assembly activity and allows the SET complex to translocate into the nucleus to nick and degrade the DNA.;Species reactivity: Bovine;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.05 ng/mL

GZMA ELISA Kit (Rat) (OKEI00778)

OKEI00778 96 Wells
EUR 767
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.938 ng/mL

Human OAF (Out at first protein homolog) ELISA Kit (CUSTOM)

ELI-38218h 96 Tests
EUR 824

EtB Out Nucleic Acid Staining Solution20,000 x RoomTemperature

FYD007-200P 200 Preps, 1 ml Ask for price

GZMA sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0923805 3 x 1.0 ug
EUR 376

CytoSelect Cell Transformation Assay (Cell Recovery Compatible), Colorimetric

CBA-135 96 assays
EUR 821
Description: CytoSelect 96-Well Cell Transformation Assays (Cell Recovery Compatible) provide a robust system for detecting transformed cells, screening cell transformation inhibitors, and determining in vitro drug sensitivity. A proprietary modified soft agar matrix allows you to either quantify cells using the included fluorescent dye, or recover the cells for further analysis.

CytoSelect Cell Transformation Assay (Cell Recovery Compatible), Colorimetric

CBA-135-5 5 x 96 assays
EUR 3356
Description: CytoSelect 96-Well Cell Transformation Assays (Cell Recovery Compatible) provide a robust system for detecting transformed cells, screening cell transformation inhibitors, and determining in vitro drug sensitivity. A proprietary modified soft agar matrix allows you to either quantify cells using the included fluorescent dye, or recover the cells for further analysis.

CytoSelect Cell Transformation Assay (Cell Recovery Compatible), Fluorometric

CBA-140 96 assays
EUR 856
Description: CytoSelect 96-Well Cell Transformation Assays (Cell Recovery Compatible) provide a robust system for detecting transformed cells, screening cell transformation inhibitors, and determining in vitro drug sensitivity. A proprietary modified soft agar matrix allows you to either quantify cells using the included fluorescent dye, or recover the cells for further analysis.

CytoSelect Cell Transformation Assay (Cell Recovery Compatible), Fluorometric

CBA-140-5 5 x 96 assays
EUR 3483
Description: CytoSelect 96-Well Cell Transformation Assays (Cell Recovery Compatible) provide a robust system for detecting transformed cells, screening cell transformation inhibitors, and determining in vitro drug sensitivity. A proprietary modified soft agar matrix allows you to either quantify cells using the included fluorescent dye, or recover the cells for further analysis.

StemTAG Stem Cell Colony Formation Assay (Cell Recovery Compatible)

CBA-325 96 assays
EUR 856
Description: Our StemTAG 96-Well Stem Cell Colony Formation Assay provides a high-throughput method to quantify ES cells in just 7-10 days, and no manual cell counting is required. Once colonies are formed, they may be analyzed in three different ways: 1. Lyse cells, then quantify in a fluorescence plate reader using dye included in the kit; 2. Lyse cells, then quantify alkaline phosphatase activity using reagents provided; or 3. Recover colonies from matrix for further culture or analysis.

StemTAG Stem Cell Colony Formation Assay (Cell Recovery Compatible)

CBA-325-5 5 x 96 assays
EUR 3361
Description: Our StemTAG 96-Well Stem Cell Colony Formation Assay provides a high-throughput method to quantify ES cells in just 7-10 days, and no manual cell counting is required. Once colonies are formed, they may be analyzed in three different ways: 1. Lyse cells, then quantify in a fluorescence plate reader using dye included in the kit; 2. Lyse cells, then quantify alkaline phosphatase activity using reagents provided; or 3. Recover colonies from matrix for further culture or analysis.

ROTOR, 6 X 5ML SWING-OUT ROTOR,1/CS

480138 1/pk
EUR 538
Description: Lab Equipment; General Purpose Centrifuges (affliated brand)

PIPET CONTROLLER - UNIVERSAL POWER SUPPLY IN:100-250V, OUT:

357489 1/pk
EUR 58
Description: Falcon Liquid Handling Equipment; Falcon Pipet Controllers and Accessories

Chicken Out at first protein homolog, oaf ELISA KIT

ELI-13285c 96 Tests
EUR 928

Rat Out at first protein homolog, Oaf ELISA KIT

ELI-15146r 96 Tests
EUR 886

Rat Out at first protein homolog (OAF) ELISA Kit

abx391739-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Out at first protein homolog (OAF) ELISA Kit

abx390101-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Leave a Reply

Your email address will not be published. Required fields are marked *