Specyficzna rekrutacja regulatorowych limfocytów T w raku jajnika
Dalton
May 21, 2021
Płynny mannequin mozaiki struktury błon komórkowych.
Este prezentat un mannequin de mozaic fluid pentru organizarea și structura brută a proteinelor și lipidelor membranelor biologice. Modelul este în concordanță cu restricțiile impuse de termodinamică. În acest mannequin, proteinele care fac parte integrantă din membrană sunt un set eterogen de molecule globulare, fiecare dispuse într-o structură amfipatică, adică cu grupările ionice și extrem de polare care ies din membrană în faza apoasă și grupurile nepolare. în mare măsură îngropat în interiorul hidrofob al membranei. Aceste molecule globulare sunt parțial încorporate într-o matrice de fosfolipide. Cea mai mare parte a fosfolipidelor este organizată ca un strat strat discontinuu, fluid, deși o mică parte a lipidei poate interacționa în mod particular cu proteinele de membrană.
Structura mozaicului fluid este, prin urmare, în mod formal similară cu o soluție bidimensională orientată de proteine integrale (sau lipoproteine) în solventul bistrat cu fosfolipide vâscoase. Sunt descrise experimente recente cu o mare varietate de tehnici și mai multe sisteme de membrană diferite, toate acestea fiind compatibile cu modelul mozaicului fluid și îi adaugă multe detalii. Prin urmare, pare adecvat să sugerăm posibile mecanisme pentru diferite funcții ale membranei și fenomene mediate de membrană în lumina modelului. Ca exemple, sunt sugerate mecanisme testabile experimental pentru modificările suprafeței celulare în transformarea malignă și pentru efectele de cooperare prezentate în interacțiunile membranelor cu unii liganzi specifici.
Notă adăugată în dovadă: De când a fost scris acest articol, am obținut dovezi microscopice electronice (69) conform cărora situsurile de legare a concanavalinei A pe membranele fibroblastelor de șoarece transformate de virusul SV40 ( celule 3T3 ) sunt mai grupate decât siturile de pe membranele celule normale , după cum se prezice prin ipoteza reprezentată în Fig. 7B. A apărut și un studiu realizat de Taylor și colab. (70) care arată efectele remarcabile produse asupra limfocitelor prin adăugarea de anticorpi direcționați către moleculele lor de imunoglobulină de suprafață.
Anticorpii induc o redistribuire și pinocitoză a acestor imunoglobuline de suprafață, astfel încât în aproximativ 30 de minute la 37 de grade C imunoglobulinele de suprafață sunt complet măturate din membrană. Aceste efecte nu apar, totuși, dacă anticorpii bivalenți sunt înlocuiți cu fragmentele lor Fab univalente sau dacă experimentele de anticorpi sunt efectuate la zero grade C în loc de 37 grade C.
Aceste și rezultatele conexe indică cu tărie că anticorpii bivalenți produc o agregare a moleculelor de imunoglobulină de suprafață în planul membranei, care pot apărea numai dacă moleculele de imunoglobulină sunt libere să difuzeze în membrană . Această agregare atuncipare să declanșeze pinocitoza componentelor membranei printr-un mecanism necunoscut. Astfel de transformări de membrană pot avea o importanță crucială în inducerea unui răspuns de anticorp la un antigen, precum și iv alte procese de diferențiere celulară .
srsf
 Gene Knock-Out HR Targeting Vector [MCS1-EF1a-GFP-T2A-Puro-pA-MCS2] |
|
HR410PA-1 |
SBI |
10 ug |
EUR 1023 |
|
|
 Gene Knock-Out HR Targeting Vector [MCS1-EF1a-RFP-T2A-Hygro-pA-MCS2] |
|
HR510PA-1 |
SBI |
10 ug |
EUR 1023 |
|
|
) TARGATT? Knock-in iPSC Generation (Master Cell Line) |
|
AST-1100 |
Applied StemCell |
1 vial of 1X10^6 cells |
Ask for price |
|
Description: 6 month |
) TARGATT? Knock-in Mouse Cell Line Generation Kit (Master Cell Line) |
|
AST-7001 |
Applied StemCell |
1 Kit |
Ask for price |
|
Description: 6 month |
 HEK-293T cells |
|
T0011002 |
Addexbio |
One Frozen vial |
EUR 455 |
) TARGATT? Knock-in CHO Generation Kit (Master Cell Line) |
|
AST-1200 |
Applied StemCell |
1 Kit |
Ask for price |
|
Description: 12 month |
) TARGATT? Knock-in HEK293 Generation Kit (Master Cell Line) |
|
AST-1300 |
Applied StemCell |
1 Kit |
Ask for price |
|
Description: 12 month |
 HEK-293T Telomerase Over-Expressing Cell Pellet |
|
abx069991-1Pellet |
Abbexa |
1 Pellet |
EUR 398 |
- Shipped within 1-3 working days.
|
 Basic HR Targeting Vector [MCS1-LoxP-MCS2-MCS3-pA-LoxP-MCS4] for Gene Knock-In/Out |
|
HR100PA-1 |
SBI |
10 ug |
EUR 938 |
|
|
 Lck 3'UTR Luciferase Stable Cell Line |
|
TU110948 |
ABM |
1.0 ml |
Ask for price |
 Lck 3'UTR GFP Stable Cell Line |
|
TU160948 |
ABM |
1.0 ml |
Ask for price |
Lck 3'UTR Luciferase Stable Cell Line |
|
TU206973 |
ABM |
1.0 ml |
Ask for price |
Lck 3'UTR GFP Stable Cell Line |
|
TU256973 |
ABM |
1.0 ml |
Ask for price |
 LCK 3'UTR GFP Stable Cell Line |
|
TU062323 |
ABM |
1.0 ml |
EUR 1394 |
 LCK 3'UTR Luciferase Stable Cell Line |
|
TU012323 |
ABM |
1.0 ml |
EUR 1394 |
 293AD Cell Line |
|
AD-100 |
Cell Biolabs |
1 vial |
EUR 461 |
|
Description: The 293AD Cell Line is derived from the parental 293 cells but selected for attributes that increase adenovirus production, including firmer attachment and larger surface area. |
 293AAV Cell Line |
|
AAV-100 |
Cell Biolabs |
1 vial |
EUR 508 |
|
Description: The 293AAV Cell Line is derived from the parental 293 cells but selected for attributes that increase AAV production, including firmer attachment and larger surface area. |
 293LTV Cell Line |
|
LTV-100 |
Cell Biolabs |
1 vial |
EUR 508 |
|
Description: The 293LTV Cell Line is derived from the parental 293 cells but selected for attributes that increase lentiviral production, including fimrer attachment and larger surface area. |
 293RTV Cell Line |
|
RV-100 |
Cell Biolabs |
1 vial |
EUR 508 |
|
Description: The 293RTV Cell Line is derived from the parental 293 cells but selected for attributes that increase retroviral production, including fimrer attachment and larger surface area. |
 Microplate Swing-Out Centrifuge |
|
abx725026-1Unit |
Abbexa |
1 Unit |
EUR 1476 |
- Shipped within 10-15 working days.
|
 Clinical Swing-Out Centrifuge |
|
abx725027-1Unit |
Abbexa |
1 Unit |
EUR 1476 |
- Shipped within 10-15 working days.
|
 and Negative Selection (TK) Against Random Integration) Gene Knock-Out HR Targeting Vector w/Single Selection Marker (Blasticidin) and Negative Selection (TK) Against Random Integration |
|
HR720PA-1 |
SBI |
10 µg |
EUR 1145 |
|
|
) Human Tyrosine-protein kinase Lck (LCK) |
|
1-CSB-EP012806HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 65.2 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
|
Description: Recombinant Human Tyrosine-protein kinase Lck(LCK) expressed in E.coli |
Human Tyrosine-protein kinase Lck (LCK) |
|
1-CSB-EP012806HUa2 |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 77.2 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
|
Description: Recombinant Human Tyrosine-protein kinase Lck(LCK) expressed in E.coli |
) 293T Transfection Kit (1 mL) |
|
P902 |
101Bio |
NULL |
EUR 0 |
) 293T Transfection Kit (0.2 mL) |
|
P902S |
101Bio |
NULL |
EUR 0 |
293T Transfection Kit (1 mL) |
|
P903 |
101Bio |
NULL |
EUR 0 |
293T Transfection Kit (0.2 mL) |
|
P903S |
101Bio |
NULL |
EUR 0 |
 293/GFP Cell Line |
|
AKR-200 |
Cell Biolabs |
1 vial |
EUR 572 |
|
Description: 293/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line. |
 T47D/GFP Cell Line |
|
AKR-208 |
Cell Biolabs |
1 vial |
EUR 572 |
|
Description: T47D/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line. |
 A549/GFP Cell Line |
|
AKR-209 |
Cell Biolabs |
1 vial |
EUR 572 |
|
Description: A549/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line. |
 HeLa/GFP Cell Line |
|
AKR-213 |
Cell Biolabs |
1 vial |
EUR 572 |
|
Description: HeLa/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line. |
 NIH3T3/GFP Cell Line |
|
AKR-214 |
Cell Biolabs |
1 vial |
EUR 572 |
|
Description: NIH3T3/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line. |
 and Negative Selection (TK) Against Random Integration) Gene Knock-Out HR Targeting Vector w/Dual Selection Markers (GFP+Puro) and Negative Selection (TK) Against Random Integration |
|
HR700PA-1 |
SBI |
10 µg |
EUR 1145 |
|
|
 and Negative Selection (TK) Against Random Integration) Gene Knock-Out HR Targeting Vector w/Dual Selection Markers (RFP+Hygro) and Negative Selection (TK) Against Random Integration |
|
HR710PA-1 |
SBI |
10 µg |
EUR 1145 |
|
|
 SKOV-3/Luc Cell Line |
|
AKR-232 |
Cell Biolabs |
1 vial |
EUR 572 |
|
Description: SKOV-3/Luc Cell Line stably expresses luciferase and otherwise exhibits the same characteristics of the parental cell line. |
 MCF-7/Luc Cell Line |
|
AKR-234 |
Cell Biolabs |
1 vial |
EUR 572 |
|
Description: MCF-7/Luc Cell Line stably expresses luciferase and otherwise exhibits the same characteristics of the parental cell line. |
 OVCAR-5/RFP Cell Line |
|
AKR-254 |
Cell Biolabs |
1 vial |
EUR 572 |
|
Description: OVCAR-5/RFP Cell Line stably expresses RFP and otherwise exhibits the same characteristics of the parental cell line. |
 Gene Knock-Out HR Targeting Vector with TK selection [MCS1-LoxP-EF1?-GFP-T2A-Puro-P2A-hsvTK-pA-LoxP-MCS2] |
|
HR210PA-1 |
SBI |
10 ug |
EUR 1145 |
|
|
 ELISA kit) Human Tyrosine protein kinase Lck(LCK) ELISA kit |
|
E01T0623-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Tyrosine protein kinase Lck(LCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Tyrosine protein kinase Lck(LCK) ELISA kit |
|
E01T0623-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Tyrosine protein kinase Lck(LCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Tyrosine protein kinase Lck(LCK) ELISA kit |
|
E01T0623-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Tyrosine protein kinase Lck(LCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Human Tyrosine- protein kinase Lck, LCK ELISA KIT |
|
ELI-31641h |
Lifescience Market |
96 Tests |
EUR 824 |
, Clone: Lck-01) Monoclonal p56lck / LCK Antibody (clone Lck-01), Clone: Lck-01 |
|
APR17729G |
Leading Biology |
0.05mg |
EUR 484 |
|
Description: A Monoclonal antibody against Human p56lck / LCK (clone Lck-01). The antibodies are raised in Mouse and are from clone Lck-01. This antibody is applicable in WB and IHC-P, ICC, IP, Flo |
) LCK sgRNA CRISPR Lentivector set (Human) |
|
K1201901 |
ABM |
3 x 1.0 ug |
EUR 339 |
 Antibody) Tyrosine-Protein Kinase Lck (LCK) Antibody |
|
abx159593-100ul |
Abbexa |
100 ul |
EUR 467 |
- Shipped within 5-10 working days.
|
 Platinum-E Retroviral Packaging Cell Line, Ecotropic |
|
RV-101 |
Cell Biolabs |
1 vial |
EUR 920 |
|
Description: Conventional cells used for retrovirus packaging, such as those based on NIH3T3 cells, have limited stability and produce relatively low yields of retrovirus, mainly due to the poor expression of retroviral structure proteins (gag, pol and env) in the cells. The Platinum Retroviral Packaging Cell Lines are based on the 293T cell line. They exhibit longer stability and produce higher yields of retroviral structure proteins. Plat-E cells contain gag, pol and env genes, allowing retroviral packaging with a single plasmid transfection. |
 Platinum-A Retroviral Packaging Cell Line, Amphotropic |
|
RV-102 |
Cell Biolabs |
1 vial |
EUR 920 |
|
Description: Conventional cells used for retrovirus packaging, such as those based on NIH3T3 cells, have limited stability and produce relatively low yields of retrovirus, mainly due to the poor expression of retroviral structure proteins (gag, pol and env) in the cells. The Platinum Retroviral Packaging Cell Lines are based on the 293T cell line. They exhibit longer stability and produce higher yields of retroviral structure proteins. Plat-A cells contain gag, pol and env genes, allowing retroviral packaging with a single plasmid transfection. |
 Platinum-GP Retroviral Packaging Cell Line, Pantropic |
|
RV-103 |
Cell Biolabs |
1 vial |
EUR 920 |
|
Description: Conventional cells used for retrovirus packaging, such as those based on NIH3T3 cells, have limited stability and produce relatively low yields of retrovirus, mainly due to the poor expression of retroviral structure proteins (gag, pol and env) in the cells. The Platinum Retroviral Packaging Cell Lines are based on the 293T cell line. They exhibit longer stability and produce higher yields of retroviral structure proteins. Plat-GP cells contain the gag and pol genes required for retroviral packaging; an expression vector is co-transfected with a VSVG envelope vector. |
 TARGATT? Knock-in iPSC Genotyping Kit |
|
AST-1102 |
Applied StemCell |
1 Kit |
Ask for price |
|
Description: 12 month |
 Lck protein |
|
30R-2848 |
Fitzgerald |
5 ug |
EUR 503 |
|
Description: Purified recombinant Human Lck protein |
 Lck antibody |
|
20R-1612 |
Fitzgerald |
100 ug |
EUR 673 |
|
Description: Rabbit polyclonal Lck antibody |
Lck antibody |
|
20R-1613 |
Fitzgerald |
100 ug |
EUR 705 |
|
Description: Rabbit polyclonal Lck antibody |
 LCK antibody |
|
20R-1997 |
Fitzgerald |
50 ug |
EUR 281 |
|
Description: Rabbit polyclonal LCK antibody |
LCK antibody |
|
20R-2166 |
Fitzgerald |
50 ug |
EUR 281 |
|
Description: Rabbit polyclonal LCK antibody |
LCK antibody |
|
20R-2987 |
Fitzgerald |
100 ul |
EUR 393 |
|
Description: Rabbit polyclonal LCK antibody |
LCK antibody |
|
70R-18229 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal LCK antibody |
Lck antibody |
|
70R-11874 |
Fitzgerald |
100 ug |
EUR 403 |
|
Description: Rabbit polyclonal Lck antibody |
LCK antibody |
|
70R-2658 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal LCK antibody raised against the N terminal of LCK |
 Lck Antibody |
|
35363-100ul |
SAB |
100ul |
EUR 390 |
Lck Antibody |
|
35446-100ul |
SAB |
100ul |
EUR 390 |
 LCK Antibody |
|
32644-100ul |
SAB |
100ul |
EUR 252 |
LCK antibody |
|
10R-2019 |
Fitzgerald |
100 ul |
EUR 435 |
|
Description: Mouse monoclonal LCK antibody |
LCK antibody |
|
10R-10823 |
Fitzgerald |
100 ug |
EUR 381 |
|
Description: Mouse monoclonal LCK antibody |
LCK antibody |
|
10R-8607 |
Fitzgerald |
100 ul |
EUR 393 |
|
Description: Mouse monoclonal LCK antibody |
LCK antibody |
|
10R-8608 |
Fitzgerald |
100 ul |
EUR 393 |
|
Description: Mouse monoclonal LCK antibody |
LCK Antibody |
|
1-CSB-PA003142 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
|
Description: A polyclonal antibody against LCK. Recognizes LCK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000 |
LCK Antibody |
|
DF6900 |
Affbiotech |
200ul |
EUR 304 |
|
Description: LCK Antibody detects endogenous levels of total LCK. |
Lck antibody |
|
70R-35606 |
Fitzgerald |
100 ug |
EUR 327 |
|
Description: Rabbit polyclonal Lck antibody |
Lck antibody |
|
70R-36662 |
Fitzgerald |
100 ug |
EUR 327 |
|
Description: Rabbit Polyclonal Lck antibody |
LCK antibody |
|
70R-49992 |
Fitzgerald |
100 ul |
EUR 287 |
|
Description: Purified Polyclonal LCK antibody |
LCK antibody |
|
70R-49993 |
Fitzgerald |
100 ul |
EUR 244 |
|
Description: Purified Polyclonal LCK antibody |
Lck antibody |
|
70R-34247 |
Fitzgerald |
100 ug |
EUR 327 |
|
Description: Rabbit polyclonal Lck antibody |
LCK antibody |
|
70R-34386 |
Fitzgerald |
100 ug |
EUR 327 |
|
Description: Rabbit polyclonal LCK antibody |
 LCK Antibody |
|
AF5412 |
Affbiotech |
200ul |
EUR 304 |
|
Description: LCK Antibody detects endogenous levels of total LCK. |
Lck Antibody |
|
AF6100 |
Affbiotech |
200ul |
EUR 304 |
|
Description: Lck Antibody detects endogenous levels of total Lck. |
Lck Antibody |
|
AF6101 |
Affbiotech |
200ul |
EUR 304 |
|
Description: Lck Antibody detects endogenous levels of total Lck. |
Lck Antibody |
|
BF0456 |
Affbiotech |
200ul |
EUR 376 |
|
Description: Lck antibody detects endogenous levels of total Lck. |
LCK Antibody |
|
1-CSB-PA012806GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against LCK. Recognizes LCK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
LCK Antibody |
|
1-CSB-PA012806LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against LCK. Recognizes LCK from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF, IP; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200, IP:1:200-1:2000 |
LCK Antibody |
|
1-CSB-PA009795 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
|
Description: A polyclonal antibody against LCK. Recognizes LCK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000 |
LCK Antibody |
|
1-CSB-PA009798 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
|
Description: A polyclonal antibody against LCK. Recognizes LCK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/40000 |
LCK Antibody |
|
1-CSB-PA009802 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
|
Description: A polyclonal antibody against LCK. Recognizes LCK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/5000 |
 LCK siRNA |
|
20-abx902944 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LCK siRNA |
|
20-abx922340 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LCK siRNA |
|
20-abx922341 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Lck Antibody |
|
AF7694 |
Affbiotech |
200ul |
EUR 376 |
|
Description: Lck Antibody detects endogenous levels of Lck. |
Lck Antibody |
|
AF7695 |
Affbiotech |
200ul |
EUR 376 |
|
Description: Lck Antibody detects endogenous levels of Lck. |
LCK Antibody |
|
AF7696 |
Affbiotech |
200ul |
EUR 376 |
|
Description: LCK Antibody detects endogenous levels of LCK. |
Sierocy receptor jądrowy RORgammat kieruje programem różnicowania prozapalnych komórek pomocniczych IL-17 + T.
IL-17-T producătoare de limfocite au fost current dovedit a cuprinde o descendență distinctă de T helper proinflamatorii celule , numite Th17 celule , care sunt o contributie majora la boli autoimune. Arătăm aici că receptorul nuclear orfan RORgammat este factorul cheie de transcripție care orchestrează diferențierea acestei linii de celule efectoare . RORgammat induce transcripția genelor care codifică IL-17 și IL-citokina înrudit 17F în naivi CD4 (+) T helper celule și este necesar pentru exprimarea lor ca răspuns la IL-6 și TGF-beta, citokinele cunoscute de a induce IL- 17.
Celulele Th17 sunt prezente în mod constitutiv în toată lamina propria intestinală, exprimă RORgammat și sunt absente la șoareci cu deficit de RORgammat sau IL-6. Șoarecii cu celule T cu deficit de RORgammat au boli autoimune atenuate și nu au celule Th17 care se infiltrează în țesuturi . Împreună, aceste studii sugerează că RORgammat este un regulator cheie al homeostaziei imune și evidențiază potențialul său ca țintă terapeutică în bolile inflamatorii.
Specyficzna rekrutacja regulatorowych limfocytów T w raku jajnika sprzyja przywilejowi immunologicznemu i pozwala przewidzieć skrócenie czasu przeżycia.
T de reglementare (T (REG)) Celulele mediază toleranță periferică homeostatic prin suprimarea T autoreactive celule . Nerespectarea imunității antitumorale gazdă poate fi cauzată de supresia exagerată antigen reactive asociate tumorii limfocite mediate de T (REG) celule ; Cu toate acestea, dovezi definitive care (REG) T celule au un rol imunopatologice in cancerul uman este lipsit. Aici ne arată, în studii detaliate ale CD4 (+) CD25 (+) FOXP3 (+) T (REG) celule in 104 persoane afectate cu carcinom ovarian, tumoarea umană T (REG) celule suprima T-tumorale specifice celulei imunitate și contribuie la creșterea tumorilor umane in vivo.
De asemenea, arătăm că celulele T (reg) tumorale sunt asociate cu un risc crescut de deces și supraviețuire redusă. Celulele T (reg) umane se deplasează și se acumulează preferențial în tumori și ascită, dar rareori intră în ganglionii limfatici care drenează în stadiile ulterioare ale cancerului.
Celulele tumorale și macrofagele microambientale produc chemokina CCL22, care mediază traficul de celule T (reg) către tumoră. Această recrutare specifică a celulelor T (reg) reprezintă un mecanism prin care tumorile pot favoriza privilegiul imunitar. Astfel, blocarea migrației sau funcției celulelor T (reg) poate ajuta la înfrângerea cancerului uman.
Przywracanie funkcji wyczerpanych limfocytów T CD8 podczas przewlekłej infekcji wirusowej
Afectarea funcțională a celulelor T specifice antigenului este o caracteristică definitorie a multor infecții cronice, dar mecanismele de bază ale disfuncției celulelor T nu sunt bine înțelese. Pentru a rezolva această problemă, am analizat genele exprimate in afectarea useful virus-specific T CD8 celule prezente la șoarecii infectați cronic cu virusul coriomeningitei limfocitare (LCMV) și a comparat aceste cu profilul genetic al T CD8 memorie functionale celule .
Aici raportăm că PD-1 (moartea programată 1; cunoscut și sub numele de Pdcd1) a fost selectiv reglat în sus de celulele T epuizate și că administrarea in vivo a anticorpilor care a blocat interacțiunea acestui receptor inhibitor cu ligandul său, PD-L1 (cunoscut și ca B7-H1), a îmbunătățit răspunsurile celulelor T.
In particular, am constatat ca , chiar si la soareci persistent infectate care au fost lipsite de celule CD4 T de celule de ajutor, blocarea PD-1 / PD-L1 cale de inhibare a avut un efect benefic asupra „neajutorat“ T CD8 celule , restabilind capacitatea lor de a suferi proliferare , secretă citokine, ucid celulele infectate și scad încărcătura virală. Blocarea căii inhibitoare a CTLA-4 ( proteina Four asociată cu limfocitele T citotoxice ) nu a avut niciun efect nici asupra funcției celulelor T , nici asupra controlului viral. Aceste studii identifică un mecanism particular de epuizare a celulelor T și definesc o strategie imunologică potențial eficientă pentru tratamentul infecțiilor virale cronice.
 ELISA Kit) Human Granzyme A (GZMA) ELISA Kit |
|
RD-GZMA-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 478 |
Human Granzyme A (GZMA) ELISA Kit |
|
RD-GZMA-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 662 |
 Human 293T Whole Cell Lysate |
|
LYSATE0032 |
BosterBio |
200ug |
EUR 150 |
|
Description: This cell lysate is prepared from human 293T using Boster's RIPA Lysis Buffer (AR0105) using a standard whole cell lysate protocol. The concentration was determined using the BCA assay process and then diluted using Dithiothreitol (DTT) and a reducing SDS sample loading buffer, heated for 5 minutes at 100˚C. |
 ELISA Kit) Mouse Granzyme A (GZMA) ELISA Kit |
|
DLR-GZMA-Mu-48T |
DL Develop |
48T |
EUR 489 |
- Should the Mouse Granzyme A (GZMA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Granzyme A (GZMA) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Mouse Granzyme A (GZMA) ELISA Kit |
|
DLR-GZMA-Mu-96T |
DL Develop |
96T |
EUR 635 |
- Should the Mouse Granzyme A (GZMA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Granzyme A (GZMA) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Mouse Granzyme A (GZMA) ELISA Kit |
|
RDR-GZMA-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Mouse Granzyme A (GZMA) ELISA Kit |
|
RDR-GZMA-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Mouse Granzyme A (GZMA) ELISA Kit |
|
RD-GZMA-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 489 |
Mouse Granzyme A (GZMA) ELISA Kit |
|
RD-GZMA-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 677 |
 AAVS1 Positive Control EGIP 293T Reporter Cell Line |
|
CAS606A-1 |
SBI |
1 Vial |
EUR 807 |
|
|
 Gene Knock-Out HR Targeting Vector [MCS1-EF1?-RFP-T2A-Puro-pA-MCS2] |
|
HR110PA-1 |
SBI |
10 ug |
EUR 1023 |
|
|
Gene Knock-Out HR Targeting Vector [MCS1-EF1a-GFP-T2A-Puro-pA-MCS2] |
|
HR410PA-1 |
SBI |
10 ug |
EUR 1023 |
|
|
Gene Knock-Out HR Targeting Vector [MCS1-EF1a-RFP-T2A-Hygro-pA-MCS2] |
|
HR510PA-1 |
SBI |
10 ug |
EUR 1023 |
|
|
TARGATT? Knock-in iPSC Generation (Master Cell Line) |
|
AST-1100 |
Applied StemCell |
1 vial of 1X10^6 cells |
Ask for price |
|
Description: 6 month |
TARGATT? Knock-in Mouse Cell Line Generation Kit (Master Cell Line) |
|
AST-7001 |
Applied StemCell |
1 Kit |
Ask for price |
|
Description: 6 month |
HEK-293T cells |
|
T0011002 |
Addexbio |
One Frozen vial |
EUR 455 |
TARGATT? Knock-in CHO Generation Kit (Master Cell Line) |
|
AST-1200 |
Applied StemCell |
1 Kit |
Ask for price |
|
Description: 12 month |
TARGATT? Knock-in HEK293 Generation Kit (Master Cell Line) |
|
AST-1300 |
Applied StemCell |
1 Kit |
Ask for price |
|
Description: 12 month |
 Gzma 3'UTR Luciferase Stable Cell Line |
|
TU109260 |
ABM |
1.0 ml |
Ask for price |
Gzma 3'UTR Luciferase Stable Cell Line |
|
TU205597 |
ABM |
1.0 ml |
Ask for price |
 Gzma 3'UTR GFP Stable Cell Line |
|
TU159260 |
ABM |
1.0 ml |
Ask for price |
Gzma 3'UTR GFP Stable Cell Line |
|
TU255597 |
ABM |
1.0 ml |
Ask for price |
 GZMA 3'UTR GFP Stable Cell Line |
|
TU059495 |
ABM |
1.0 ml |
EUR 1394 |
 GZMA 3'UTR Luciferase Stable Cell Line |
|
TU009495 |
ABM |
1.0 ml |
EUR 1394 |
HEK-293T Telomerase Over-Expressing Cell Pellet |
|
abx069991-1Pellet |
Abbexa |
1 Pellet |
EUR 398 |
- Shipped within 1-3 working days.
|
Basic HR Targeting Vector [MCS1-LoxP-MCS2-MCS3-pA-LoxP-MCS4] for Gene Knock-In/Out |
|
HR100PA-1 |
SBI |
10 ug |
EUR 938 |
|
|
293AD Cell Line |
|
AD-100 |
Cell Biolabs |
1 vial |
EUR 461 |
|
Description: The 293AD Cell Line is derived from the parental 293 cells but selected for attributes that increase adenovirus production, including firmer attachment and larger surface area. |
293AAV Cell Line |
|
AAV-100 |
Cell Biolabs |
1 vial |
EUR 508 |
|
Description: The 293AAV Cell Line is derived from the parental 293 cells but selected for attributes that increase AAV production, including firmer attachment and larger surface area. |
293LTV Cell Line |
|
LTV-100 |
Cell Biolabs |
1 vial |
EUR 508 |
|
Description: The 293LTV Cell Line is derived from the parental 293 cells but selected for attributes that increase lentiviral production, including fimrer attachment and larger surface area. |
293RTV Cell Line |
|
RV-100 |
Cell Biolabs |
1 vial |
EUR 508 |
|
Description: The 293RTV Cell Line is derived from the parental 293 cells but selected for attributes that increase retroviral production, including fimrer attachment and larger surface area. |
Microplate Swing-Out Centrifuge |
|
abx725026-1Unit |
Abbexa |
1 Unit |
EUR 1476 |
- Shipped within 10-15 working days.
|
Clinical Swing-Out Centrifuge |
|
abx725027-1Unit |
Abbexa |
1 Unit |
EUR 1476 |
- Shipped within 10-15 working days.
|
Gene Knock-Out HR Targeting Vector w/Single Selection Marker (Blasticidin) and Negative Selection (TK) Against Random Integration |
|
HR720PA-1 |
SBI |
10 µg |
EUR 1145 |
|
|
293T Transfection Kit (1 mL) |
|
P902 |
101Bio |
NULL |
EUR 0 |
293T Transfection Kit (0.2 mL) |
|
P902S |
101Bio |
NULL |
EUR 0 |
293T Transfection Kit (1 mL) |
|
P903 |
101Bio |
NULL |
EUR 0 |
293T Transfection Kit (0.2 mL) |
|
P903S |
101Bio |
NULL |
EUR 0 |
293/GFP Cell Line |
|
AKR-200 |
Cell Biolabs |
1 vial |
EUR 572 |
|
Description: 293/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line. |
T47D/GFP Cell Line |
|
AKR-208 |
Cell Biolabs |
1 vial |
EUR 572 |
|
Description: T47D/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line. |
A549/GFP Cell Line |
|
AKR-209 |
Cell Biolabs |
1 vial |
EUR 572 |
|
Description: A549/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line. |
HeLa/GFP Cell Line |
|
AKR-213 |
Cell Biolabs |
1 vial |
EUR 572 |
|
Description: HeLa/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line. |
NIH3T3/GFP Cell Line |
|
AKR-214 |
Cell Biolabs |
1 vial |
EUR 572 |
|
Description: NIH3T3/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line. |
 GZMA antibody |
|
70R-17667 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal GZMA antibody |
 GZMA Antibody |
|
DF9054 |
Affbiotech |
200ul |
EUR 304 |
|
Description: GZMA Antibody detects endogenous levels of total GZMA. |
GZMA antibody |
|
70R-9289 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Affinity purified rabbit polyclonal GZMA antibody |
GZMA Antibody |
|
1-CSB-PA009084 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
|
Description: A polyclonal antibody against GZMA. Recognizes GZMA from Human. This antibody is Unconjugated. Tested in the following application: IHC, IF, ELISA;IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000 |
GZMA Antibody |
|
1-CSB-PA010081ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against GZMA. Recognizes GZMA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
GZMA Antibody |
|
1-CSB-PA010081GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against GZMA. Recognizes GZMA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
 Gzma Antibody |
|
1-CSB-PA010081LA01MO |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against Gzma. Recognizes Gzma from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000 |
 GZMA siRNA |
|
20-abx918982 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GZMA siRNA |
|
20-abx918983 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Gene Knock-Out HR Targeting Vector w/Dual Selection Markers (GFP+Puro) and Negative Selection (TK) Against Random Integration |
|
HR700PA-1 |
SBI |
10 µg |
EUR 1145 |
|
|
Gene Knock-Out HR Targeting Vector w/Dual Selection Markers (RFP+Hygro) and Negative Selection (TK) Against Random Integration |
|
HR710PA-1 |
SBI |
10 µg |
EUR 1145 |
|
|
) GZMA sgRNA CRISPR Lentivector set (Human) |
|
K0923801 |
ABM |
3 x 1.0 ug |
EUR 339 |
SKOV-3/Luc Cell Line |
|
AKR-232 |
Cell Biolabs |
1 vial |
EUR 572 |
|
Description: SKOV-3/Luc Cell Line stably expresses luciferase and otherwise exhibits the same characteristics of the parental cell line. |
MCF-7/Luc Cell Line |
|
AKR-234 |
Cell Biolabs |
1 vial |
EUR 572 |
|
Description: MCF-7/Luc Cell Line stably expresses luciferase and otherwise exhibits the same characteristics of the parental cell line. |
OVCAR-5/RFP Cell Line |
|
AKR-254 |
Cell Biolabs |
1 vial |
EUR 572 |
|
Description: OVCAR-5/RFP Cell Line stably expresses RFP and otherwise exhibits the same characteristics of the parental cell line. |
 Human GZMA shRNA Plasmid |
|
20-abx952036 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) GZMA Recombinant Protein (Human) |
|
RP014302 |
ABM |
100 ug |
Ask for price |
Gene Knock-Out HR Targeting Vector with TK selection [MCS1-LoxP-EF1?-GFP-T2A-Puro-P2A-hsvTK-pA-LoxP-MCS2] |
|
HR210PA-1 |
SBI |
10 ug |
EUR 1145 |
|
|
 (Target 1)) GZMA sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0923802 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) GZMA sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K0923803 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) GZMA sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K0923804 |
ABM |
1.0 ug DNA |
EUR 154 |
Platinum-E Retroviral Packaging Cell Line, Ecotropic |
|
RV-101 |
Cell Biolabs |
1 vial |
EUR 920 |
|
Description: Conventional cells used for retrovirus packaging, such as those based on NIH3T3 cells, have limited stability and produce relatively low yields of retrovirus, mainly due to the poor expression of retroviral structure proteins (gag, pol and env) in the cells. The Platinum Retroviral Packaging Cell Lines are based on the 293T cell line. They exhibit longer stability and produce higher yields of retroviral structure proteins. Plat-E cells contain gag, pol and env genes, allowing retroviral packaging with a single plasmid transfection. |
Platinum-A Retroviral Packaging Cell Line, Amphotropic |
|
RV-102 |
Cell Biolabs |
1 vial |
EUR 920 |
|
Description: Conventional cells used for retrovirus packaging, such as those based on NIH3T3 cells, have limited stability and produce relatively low yields of retrovirus, mainly due to the poor expression of retroviral structure proteins (gag, pol and env) in the cells. The Platinum Retroviral Packaging Cell Lines are based on the 293T cell line. They exhibit longer stability and produce higher yields of retroviral structure proteins. Plat-A cells contain gag, pol and env genes, allowing retroviral packaging with a single plasmid transfection. |
Platinum-GP Retroviral Packaging Cell Line, Pantropic |
|
RV-103 |
Cell Biolabs |
1 vial |
EUR 920 |
|
Description: Conventional cells used for retrovirus packaging, such as those based on NIH3T3 cells, have limited stability and produce relatively low yields of retrovirus, mainly due to the poor expression of retroviral structure proteins (gag, pol and env) in the cells. The Platinum Retroviral Packaging Cell Lines are based on the 293T cell line. They exhibit longer stability and produce higher yields of retroviral structure proteins. Plat-GP cells contain the gag and pol genes required for retroviral packaging; an expression vector is co-transfected with a VSVG envelope vector. |
 GZMA Blocking Peptide |
|
33R-5360 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GZMA antibody, catalog no. 70R-9289 |
 GZMA Polyclonal Antibody |
|
42195-100ul |
SAB |
100ul |
EUR 333 |
GZMA Blocking Peptide |
|
DF9054-BP |
Affbiotech |
1mg |
EUR 195 |
 GZMA cloning plasmid |
|
CSB-CL010081HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 789
- Sequence: atgaggaactcctatagatttctggcatcctctctctcagttgtcgtttctctcctgctaattcctgaagatgtctgtgaaaaaattattggaggaaatgaagtaactcctcattcaagaccctacatggtcctacttagtcttgacagaaaaaccatctgtgctggggctttgat
- Show more
|
|
Description: A cloning plasmid for the GZMA gene. |
 Gzma Polyclonal Antibody |
|
A59334 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: kits suitable for this type of research |
 GZMA Rabbit pAb |
|
A6231-100ul |
Abclonal |
100 ul |
EUR 308 |
GZMA Rabbit pAb |
|
A6231-200ul |
Abclonal |
200 ul |
EUR 459 |
GZMA Rabbit pAb |
|
A6231-20ul |
Abclonal |
20 ul |
EUR 183 |
GZMA Rabbit pAb |
|
A6231-50ul |
Abclonal |
50 ul |
EUR 223 |
 Anti-GZMA antibody |
|
STJ27987 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: Cytolytic T lymphocytes (CTL) and natural killer (NK) cells share the remarkable ability to recognize, bind, and lyse specific target cells. They are thought to protect their host by lysing cells bearing on their surface 'nonself' antigens, usually peptides or proteins resulting from infection by intracellular pathogens. The protein described here is a T cell- and natural killer cell-specific serine protease that may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells. |
) Anti-GZMA (4C6) |
|
YF-MA20335 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to GZMA |
TARGATT? Knock-in iPSC Genotyping Kit |
|
AST-1102 |
Applied StemCell |
1 Kit |
Ask for price |
|
Description: 12 month |
 Protein) Human Granzyme A (GZMA) Protein |
|
20-abx653630 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Human Granzyme A (GZMA) Protein |
|
20-abx653632 |
Abbexa |
-
EUR 885.00
-
EUR 328.00
-
EUR 2834.00
-
EUR 1052.00
-
EUR 606.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Human Granzyme A (GZMA) Protein |
|
20-abx651491 |
Abbexa |
-
EUR 732.00
-
EUR 286.00
-
EUR 2305.00
-
EUR 885.00
-
EUR 523.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
 (pORF)) GZMA ORF Vector (Human) (pORF) |
|
ORF004768 |
ABM |
1.0 ug DNA |
EUR 95 |
 (OKAN05337)) GZMA ELISA Kit (Human) (OKAN05337) |
|
OKAN05337 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
|
Description: Description of target: Cytolytic T lymphocytes (CTL) and natural killer (NK) cells share the remarkable ability to recognize, bind, and lyse specific target cells. They are thought to protect their host by lysing cells bearing on their surface 'nonself' antigens, usually peptides or proteins resulting from infection by intracellular pathogens. The protein described here is a T cell- and natural killer cell-specific serine protease that may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.055 ng/mL |
 (OKBB00906)) GZMA ELISA Kit (Human) (OKBB00906) |
|
OKBB00906 |
Aviva Systems Biology |
96 Wells |
EUR 505 |
|
Description: Description of target: Granzyme A is a protein that in humans is encoded by the GZMA gene. Cytolytic T lymphocytes (CTL) and natural killer (NK) cells share the remarkable ability to recognize, bind, and lyse specific target cells. They are thought to protect their host by lysing cells bearing on their surface "nonself" antigens, usually peptides or proteins resulting from infection by intracellular pathogens. The protein described here is a T cell- and natural killer cell-specific serine protease that may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells. GZMA induces caspase-independent apoptosis in a characteristic manner, except it causes a distinctive form of DNA damage: single-stranded DNA nicking. A target of GZMA is the SET complex, including HMGB2 and ANP32A.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml |
 (OKCD05260)) GZMA ELISA Kit (Human) (OKCD05260) |
|
OKCD05260 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
|
Description: Description of target: Cytolytic T lymphocytes (CTL) and natural killer (NK) cells share the remarkable ability to recognize, bind, and lyse specific target cells. They are thought to protect their host by lysing cells bearing on their surface 'nonself' antigens, usually peptides or proteins resulting from infection by intracellular pathogens. The protein described here is a T cell- and natural killer cell-specific serine protease that may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells. Cytolytic T lymphocytes (CTL) and natural killer (NK) cells share the remarkable ability to recognize, bind, and lyse specific target cells. They are thought to protect their host by lysing cells bearing on their surface 'nonself' antigens, usually peptides or proteins resulting from infection by intracellular pathogens. The protein described here is a T cell- and natural killer cell-specific serine protease that may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Entrez Gene record to access additional publications.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 5.7pg/mL |
 (OKCD06562)) GZMA ELISA Kit (Human) (OKCD06562) |
|
OKCD06562 |
Aviva Systems Biology |
96 Wells |
EUR 753 |
|
Description: Description of target: Cytolytic T lymphocytes (CTL) and natural killer (NK) cells share the remarkable ability to recognize, bind, and lyse specific target cells. They are thought to protect their host by lysing cells bearing on their surface 'nonself' antigens, usually peptides or proteins resulting from infection by intracellular pathogens. The protein described here is a T cell- and natural killer cell-specific serine protease that may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells. Cytolytic T lymphocytes (CTL) and natural killer (NK) cells share the remarkable ability to recognize, bind, and lyse specific target cells. They are thought to protect their host by lysing cells bearing on their surface 'nonself' antigens, usually peptides or proteins resulting from infection by intracellular pathogens. The protein described here is a T cell- and natural killer cell-specific serine protease that may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Entrez Gene record to access additional publications.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.055ng/mL |
) PinPoint-FC 293T Platform Cell Line for Targeted Gene Insertion (with PinPoint site already placed) |
|
PIN320A-1 |
SBI |
>2x10^5 cells |
EUR 3104 |
- Category: PinPoint Integrase Tools
|
 Total Protein - Murine Embryonic Stem Cell Line D3 |
|
CBA-305 |
Cell Biolabs |
500 ?g |
EUR 345 |
Description: - Isolated from mouse ES-D3 cell line
- Presented as 500 µg at 1 mg/mL in NP-40 Solubilization Buffer
|
