Specyficzna rekrutacja regulatorowych limfocytów T w raku jajnika

Płynny mannequin mozaiki struktury błon komórkowych.

 Este prezentat un mannequin de mozaic fluid pentru organizarea și structura brută a proteinelor și lipidelor membranelor biologice. Modelul este în concordanță cu restricțiile impuse de termodinamică. În acest mannequin, proteinele care fac parte integrantă din membrană sunt un set eterogen de molecule globulare, fiecare dispuse într-o structură amfipatică, adică cu grupările ionice și extrem de polare care ies din membrană în faza apoasă și grupurile nepolare. în mare măsură îngropat în interiorul hidrofob al membranei. Aceste molecule globulare sunt parțial încorporate într-o matrice de fosfolipide. Cea mai mare parte a fosfolipidelor este organizată ca un strat strat discontinuu, fluid, deși o mică parte a lipidei poate interacționa în mod particular cu proteinele de membrană.

Structura mozaicului fluid este, prin urmare, în mod formal similară cu o soluție bidimensională orientată de proteine ​​integrale (sau lipoproteine) în solventul bistrat cu fosfolipide vâscoase. Sunt descrise experimente recente cu o mare varietate de tehnici și mai multe sisteme de membrană diferite, toate acestea fiind compatibile cu modelul mozaicului fluid și îi adaugă multe detalii. Prin urmare, pare adecvat să sugerăm posibile mecanisme pentru diferite funcții ale membranei și fenomene mediate de membrană în lumina modelului. Ca exemple, sunt sugerate mecanisme testabile experimental pentru   modificările suprafeței celulare în transformarea malignă și pentru efectele de cooperare prezentate în interacțiunile membranelor cu unii liganzi specifici.

Notă adăugată în dovadă: De când a fost scris acest articol, am obținut dovezi microscopice electronice (69) conform cărora situsurile de legare a concanavalinei A pe membranele fibroblastelor de șoarece transformate de virusul SV40 ( celule 3T3  ) sunt mai grupate decât siturile de pe membranele celule normale  , după cum se prezice prin ipoteza reprezentată în Fig. 7B. A apărut și un studiu realizat de Taylor și colab. (70) care arată efectele remarcabile produse asupra  limfocitelor  prin adăugarea de anticorpi direcționați către moleculele lor de imunoglobulină de suprafață.

Anticorpii induc o redistribuire și pinocitoză a acestor imunoglobuline de suprafață, astfel încât în ​​aproximativ 30 de minute la 37 de grade C imunoglobulinele de suprafață sunt complet măturate din membrană. Aceste efecte nu apar, totuși, dacă anticorpii bivalenți sunt înlocuiți cu fragmentele lor Fab univalente sau dacă experimentele de anticorpi sunt efectuate la zero grade C în loc de 37 grade C.

Aceste și rezultatele conexe indică cu tărie că anticorpii bivalenți produc o agregare a moleculelor de imunoglobulină de suprafață în planul membranei, care pot apărea numai dacă moleculele de imunoglobulină sunt libere să difuzeze în membrană . Această agregare atuncipare să declanșeze pinocitoza componentelor membranei printr-un mecanism necunoscut. Astfel de transformări de membrană pot avea o importanță crucială în inducerea unui răspuns de anticorp la un antigen, precum și iv alte procese de   diferențiere celulară .

Gene Knock-Out HR Targeting Vector [MCS1-EF1a-GFP-T2A-Puro-pA-MCS2]
HR410PA-1	SBI	10 ug	EUR 1023
Category: HR Donors

Gene Knock-Out HR Targeting Vector [MCS1-EF1a-RFP-T2A-Hygro-pA-MCS2]
HR510PA-1	SBI	10 ug	EUR 1023
Category: HR Donors

TARGATT? Knock-in iPSC Generation (Master Cell Line)
AST-1100	Applied StemCell	1 vial of 1X10^6 cells	Ask for price
Description: 6 month

TARGATT? Knock-in Mouse Cell Line Generation Kit (Master Cell Line)
AST-7001	Applied StemCell	1 Kit	Ask for price
Description: 6 month

HEK-293T cells
T0011002	Addexbio	One Frozen vial	EUR 455

TARGATT? Knock-in CHO Generation Kit (Master Cell Line)
AST-1200	Applied StemCell	1 Kit	Ask for price
Description: 12 month

TARGATT? Knock-in HEK293 Generation Kit (Master Cell Line)
AST-1300	Applied StemCell	1 Kit	Ask for price
Description: 12 month

HEK-293T Telomerase Over-Expressing Cell Pellet
abx069991-1Pellet	Abbexa	1 Pellet	EUR 398
Shipped within 1-3 working days.

Basic HR Targeting Vector [MCS1-LoxP-MCS2-MCS3-pA-LoxP-MCS4] for Gene Knock-In/Out
HR100PA-1	SBI	10 ug	EUR 938
Category: HR Donors

Lck 3'UTR Luciferase Stable Cell Line
TU110948	ABM	1.0 ml	Ask for price

Lck 3'UTR GFP Stable Cell Line
TU160948	ABM	1.0 ml	Ask for price

Lck 3'UTR Luciferase Stable Cell Line
TU206973	ABM	1.0 ml	Ask for price

Lck 3'UTR GFP Stable Cell Line
TU256973	ABM	1.0 ml	Ask for price

LCK 3'UTR GFP Stable Cell Line
TU062323	ABM	1.0 ml	EUR 1394

LCK 3'UTR Luciferase Stable Cell Line
TU012323	ABM	1.0 ml	EUR 1394

293AD Cell Line
AD-100	Cell Biolabs	1 vial	EUR 461
Description: The 293AD Cell Line is derived from the parental 293 cells but selected for attributes that increase adenovirus production, including firmer attachment and larger surface area.

293AAV Cell Line
AAV-100	Cell Biolabs	1 vial	EUR 508
Description: The 293AAV Cell Line is derived from the parental 293 cells but selected for attributes that increase AAV production, including firmer attachment and larger surface area.

293LTV Cell Line
LTV-100	Cell Biolabs	1 vial	EUR 508
Description: The 293LTV Cell Line is derived from the parental 293 cells but selected for attributes that increase lentiviral production, including fimrer attachment and larger surface area.

293RTV Cell Line
RV-100	Cell Biolabs	1 vial	EUR 508
Description: The 293RTV Cell Line is derived from the parental 293 cells but selected for attributes that increase retroviral production, including fimrer attachment and larger surface area.

Microplate Swing-Out Centrifuge
abx725026-1Unit	Abbexa	1 Unit	EUR 1476
Shipped within 10-15 working days.

Clinical Swing-Out Centrifuge
abx725027-1Unit	Abbexa	1 Unit	EUR 1476
Shipped within 10-15 working days.

Gene Knock-Out HR Targeting Vector w/Single Selection Marker (Blasticidin) and Negative Selection (TK) Against Random Integration
HR720PA-1	SBI	10 µg	EUR 1145
Category: HR Donors

Human Tyrosine-protein kinase Lck (LCK)
1-CSB-EP012806HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 65.2 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Tyrosine-protein kinase Lck(LCK) expressed in E.coli

Human Tyrosine-protein kinase Lck (LCK)
1-CSB-EP012806HUa2	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 77.2 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Tyrosine-protein kinase Lck(LCK) expressed in E.coli

293T Transfection Kit (1 mL)
P902	101Bio	NULL	EUR 0

293T Transfection Kit (0.2 mL)
P902S	101Bio	NULL	EUR 0

293T Transfection Kit (1 mL)
P903	101Bio	NULL	EUR 0

293T Transfection Kit (0.2 mL)
P903S	101Bio	NULL	EUR 0

293/GFP Cell Line
AKR-200	Cell Biolabs	1 vial	EUR 572
Description: 293/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.

T47D/GFP Cell Line
AKR-208	Cell Biolabs	1 vial	EUR 572
Description: T47D/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.

A549/GFP Cell Line
AKR-209	Cell Biolabs	1 vial	EUR 572
Description: A549/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.

HeLa/GFP Cell Line
AKR-213	Cell Biolabs	1 vial	EUR 572
Description: HeLa/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.

NIH3T3/GFP Cell Line
AKR-214	Cell Biolabs	1 vial	EUR 572
Description: NIH3T3/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.

NIH3T3/Cas9 Cell Line
AKR-5104	Cell Biolabs	1 vial	EUR 572

293/Cas9 Cell Line
AKR-5110	Cell Biolabs	1 vial	EUR 572

HeLa/Cas9 Cell Line
AKR-5111	Cell Biolabs	1 vial	EUR 572

Gene Knock-Out HR Targeting Vector w/Dual Selection Markers (GFP+Puro) and Negative Selection (TK) Against Random Integration
HR700PA-1	SBI	10 µg	EUR 1145
Category: HR Donors

Gene Knock-Out HR Targeting Vector w/Dual Selection Markers (RFP+Hygro) and Negative Selection (TK) Against Random Integration
HR710PA-1	SBI	10 µg	EUR 1145
Category: HR Donors

SKOV-3/Luc Cell Line
AKR-232	Cell Biolabs	1 vial	EUR 572
Description: SKOV-3/Luc Cell Line stably expresses luciferase and otherwise exhibits the same characteristics of the parental cell line.

MCF-7/Luc Cell Line
AKR-234	Cell Biolabs	1 vial	EUR 572
Description: MCF-7/Luc Cell Line stably expresses luciferase and otherwise exhibits the same characteristics of the parental cell line.

OVCAR-5/RFP Cell Line
AKR-254	Cell Biolabs	1 vial	EUR 572
Description: OVCAR-5/RFP Cell Line stably expresses RFP and otherwise exhibits the same characteristics of the parental cell line.

Lck/ Rat Lck ELISA Kit
ELI-38801r	Lifescience Market	96 Tests	EUR 886

Gene Knock-Out HR Targeting Vector with TK selection [MCS1-LoxP-EF1?-GFP-T2A-Puro-P2A-hsvTK-pA-LoxP-MCS2]
HR210PA-1	SBI	10 ug	EUR 1145
Category: HR Donors

Human Tyrosine protein kinase Lck(LCK) ELISA kit
E01T0623-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Tyrosine protein kinase Lck(LCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tyrosine protein kinase Lck(LCK) ELISA kit
E01T0623-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Tyrosine protein kinase Lck(LCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tyrosine protein kinase Lck(LCK) ELISA kit
E01T0623-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Tyrosine protein kinase Lck(LCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tyrosine- protein kinase Lck, LCK ELISA KIT
ELI-31641h	Lifescience Market	96 Tests	EUR 824

Monoclonal p56lck / LCK Antibody (clone Lck-01), Clone: Lck-01
APR17729G	Leading Biology	0.05mg	EUR 484
Description: A Monoclonal antibody against Human p56lck / LCK (clone Lck-01). The antibodies are raised in Mouse and are from clone Lck-01. This antibody is applicable in WB and IHC-P, ICC, IP, Flo

LCK sgRNA CRISPR Lentivector set (Human)
K1201901	ABM	3 x 1.0 ug	EUR 339

Tyrosine-Protein Kinase Lck (LCK) Antibody
abx159593-100ul	Abbexa	100 ul	EUR 467
Shipped within 5-10 working days.

Platinum-E Retroviral Packaging Cell Line, Ecotropic
RV-101	Cell Biolabs	1 vial	EUR 920
Description: Conventional cells used for retrovirus packaging, such as those based on NIH3T3 cells, have limited stability and produce relatively low yields of retrovirus, mainly due to the poor expression of retroviral structure proteins (gag, pol and env) in the cells. The Platinum Retroviral Packaging Cell Lines are based on the 293T cell line. They exhibit longer stability and produce higher yields of retroviral structure proteins. Plat-E cells contain gag, pol and env genes, allowing retroviral packaging with a single plasmid transfection.

Platinum-A Retroviral Packaging Cell Line, Amphotropic
RV-102	Cell Biolabs	1 vial	EUR 920
Description: Conventional cells used for retrovirus packaging, such as those based on NIH3T3 cells, have limited stability and produce relatively low yields of retrovirus, mainly due to the poor expression of retroviral structure proteins (gag, pol and env) in the cells. The Platinum Retroviral Packaging Cell Lines are based on the 293T cell line. They exhibit longer stability and produce higher yields of retroviral structure proteins. Plat-A cells contain gag, pol and env genes, allowing retroviral packaging with a single plasmid transfection.

Platinum-GP Retroviral Packaging Cell Line, Pantropic
RV-103	Cell Biolabs	1 vial	EUR 920
Description: Conventional cells used for retrovirus packaging, such as those based on NIH3T3 cells, have limited stability and produce relatively low yields of retrovirus, mainly due to the poor expression of retroviral structure proteins (gag, pol and env) in the cells. The Platinum Retroviral Packaging Cell Lines are based on the 293T cell line. They exhibit longer stability and produce higher yields of retroviral structure proteins. Plat-GP cells contain the gag and pol genes required for retroviral packaging; an expression vector is co-transfected with a VSVG envelope vector.

TARGATT? Knock-in iPSC Genotyping Kit
AST-1102	Applied StemCell	1 Kit	Ask for price
Description: 12 month

Lck protein
30R-2848	Fitzgerald	5 ug	EUR 503
Description: Purified recombinant Human Lck protein

Lck antibody
20R-1612	Fitzgerald	100 ug	EUR 673
Description: Rabbit polyclonal Lck antibody

Lck antibody
20R-1613	Fitzgerald	100 ug	EUR 705
Description: Rabbit polyclonal Lck antibody

LCK antibody
20R-1997	Fitzgerald	50 ug	EUR 281
Description: Rabbit polyclonal LCK antibody

LCK antibody
20R-2166	Fitzgerald	50 ug	EUR 281
Description: Rabbit polyclonal LCK antibody

LCK antibody
20R-2987	Fitzgerald	100 ul	EUR 393
Description: Rabbit polyclonal LCK antibody

LCK antibody
70R-18229	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal LCK antibody

Lck antibody
70R-11874	Fitzgerald	100 ug	EUR 403
Description: Rabbit polyclonal Lck antibody

LCK antibody
70R-2658	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal LCK antibody raised against the N terminal of LCK

Lck Antibody
3498-100	Biovision		EUR 316

Lck Antibody
3498-30T	Biovision		EUR 146

Lck Antibody
35363-100ul	SAB	100ul	EUR 390

Lck Antibody
35446-100ul	SAB	100ul	EUR 390

LCK Antibody
32644-100ul	SAB	100ul	EUR 252

LCK antibody
10R-2019	Fitzgerald	100 ul	EUR 435
Description: Mouse monoclonal LCK antibody

LCK antibody
10R-10823	Fitzgerald	100 ug	EUR 381
Description: Mouse monoclonal LCK antibody

LCK antibody
10R-8607	Fitzgerald	100 ul	EUR 393
Description: Mouse monoclonal LCK antibody

LCK antibody
10R-8608	Fitzgerald	100 ul	EUR 393
Description: Mouse monoclonal LCK antibody

LCK Antibody
1-CSB-PA003142	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against LCK. Recognizes LCK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

LCK Antibody
DF6900	Affbiotech	200ul	EUR 304
Description: LCK Antibody detects endogenous levels of total LCK.

Lck, Active
7733-5	Biovision		EUR 370

Lck antibody
70R-35606	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal Lck antibody

Lck antibody
70R-36662	Fitzgerald	100 ug	EUR 327
Description: Rabbit Polyclonal Lck antibody

LCK antibody
70R-49992	Fitzgerald	100 ul	EUR 287
Description: Purified Polyclonal LCK antibody

LCK antibody
70R-49993	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal LCK antibody

Lck antibody
70R-34247	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal Lck antibody

LCK antibody
70R-34386	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal LCK antibody

LCK Antibody
AF5412	Affbiotech	200ul	EUR 304
Description: LCK Antibody detects endogenous levels of total LCK.

Lck Antibody
AF6100	Affbiotech	200ul	EUR 304
Description: Lck Antibody detects endogenous levels of total Lck.

Lck Antibody
AF6101	Affbiotech	200ul	EUR 304
Description: Lck Antibody detects endogenous levels of total Lck.

Lck Antibody
BF0456	Affbiotech	200ul	EUR 376
Description: Lck antibody detects endogenous levels of total Lck.

LCK Antibody
1-CSB-PA012806GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against LCK. Recognizes LCK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

LCK Antibody
1-CSB-PA012806LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LCK. Recognizes LCK from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF, IP; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200, IP:1:200-1:2000

LCK Antibody
1-CSB-PA009795	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against LCK. Recognizes LCK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

LCK Antibody
1-CSB-PA009798	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against LCK. Recognizes LCK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/40000

LCK Antibody
1-CSB-PA009802	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against LCK. Recognizes LCK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/5000

LCK siRNA
20-abx902944	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

LCK siRNA
20-abx922340	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

LCK siRNA
20-abx922341	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Lck Antibody
AF7694	Affbiotech	200ul	EUR 376
Description: Lck Antibody detects endogenous levels of Lck.

Lck Antibody
AF7695	Affbiotech	200ul	EUR 376
Description: Lck Antibody detects endogenous levels of Lck.

LCK Antibody
AF7696	Affbiotech	200ul	EUR 376
Description: LCK Antibody detects endogenous levels of LCK.

LCK Antibody
ABF5412	Lifescience Market	100 ug	EUR 438

Lck Antibody
ABF6100	Lifescience Market	100 ug	EUR 438

Lck Antibody
ABF6101	Lifescience Market	100 ug	EUR 438

LCK Antibody
ABD6900	Lifescience Market	100 ug	EUR 438

Lck Inhibitor
A3539-1	ApexBio	1 mg	EUR 154
Description: Lck Inhibitor is a small-molecule inhibitor of with IC50 value of 7 nM [1].The lymphocyte specific kinase which expressed in NK cells and T-cells is a member of the Src kinase family.

Lck Inhibitor
A3539-5	ApexBio	5 mg	EUR 222
Description: Lck Inhibitor is a small-molecule inhibitor of with IC50 value of 7 nM [1].The lymphocyte specific kinase which expressed in NK cells and T-cells is a member of the Src kinase family.

Lck Inhibitor
HY-12072	MedChemExpress	100mg	EUR 2019

anti-LCK
LF-PA0206	Abfrontier	100 ul	EUR 334
Description: Rabbit polyclonal to LCK

anti-Lck
YF-PA12927	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to Lck

Lck Colorimetric Cell-Based ELISA Kit
EKC1338	BosterBio	100ul	EUR 572

PinPoint-FC 293T Platform Cell Line for Targeted Gene Insertion (with PinPoint site already placed)
PIN320A-1	SBI	>2x10^5 cells	EUR 3104
Category: PinPoint Integrase Tools

LCK ELISA KIT|Human
EF010640	Lifescience Market	96 Tests	EUR 689

Human LCK shRNA Plasmid
20-abx952664	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Total Protein - Murine Embryonic Stem Cell Line D3
CBA-305	Cell Biolabs	500 ?g	EUR 345
Description: Isolated from mouse ES-D3 cell line Presented as 500 µg at 1 mg/mL in NP-40 Solubilization Buffer

LCK sgRNA CRISPR Lentivector (Human) (Target 1)
K1201902	ABM	1.0 ug DNA	EUR 154

LCK sgRNA CRISPR Lentivector (Human) (Target 2)
K1201903	ABM	1.0 ug DNA	EUR 154

LCK sgRNA CRISPR Lentivector (Human) (Target 3)
K1201904	ABM	1.0 ug DNA	EUR 154

Human Proto-Oncogene Tyrosine-Protein Kinase LCK (LCK) ELISA Kit
abx388241-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

TARGATT? Knock-in iPSC Quick Knockin Kit
AST-1101	Applied StemCell	1 Kit	Ask for price
Description: 12 month

Rat Tyrosine protein kinase Lck(LCK) ELISA kit
E02T0623-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Tyrosine protein kinase Lck(LCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Tyrosine protein kinase Lck(LCK) ELISA kit
E02T0623-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Tyrosine protein kinase Lck(LCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Tyrosine protein kinase Lck(LCK) ELISA kit
E02T0623-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Tyrosine protein kinase Lck(LCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Tyrosine protein kinase Lck(LCK) ELISA kit
E04T0623-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Tyrosine protein kinase Lck(LCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Tyrosine protein kinase Lck(LCK) ELISA kit
E04T0623-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Tyrosine protein kinase Lck(LCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Sierocy receptor jądrowy RORgammat kieruje programem różnicowania prozapalnych komórek pomocniczych IL-17 + T.

IL-17-T producătoare  de limfocite  au fost current dovedit a cuprinde o descendență distinctă de T helper proinflamatorii  celule , numite Th17  celule , care sunt o contributie majora la boli autoimune. Arătăm aici că receptorul nuclear orfan RORgammat este factorul cheie de transcripție care orchestrează diferențierea acestei  linii de celule efectoare  . RORgammat induce transcripția genelor care codifică IL-17 și IL-citokina înrudit 17F în naivi CD4 (+) T helper  celule  și este necesar pentru exprimarea lor ca răspuns la IL-6 și TGF-beta, citokinele cunoscute de a induce IL- 17.

Celulele Th17   sunt prezente în mod constitutiv în toată lamina propria intestinală, exprimă RORgammat și sunt absente la șoareci cu deficit de RORgammat sau IL-6. Șoarecii cu celule T cu deficit de RORgammat   au boli autoimune atenuate și nu au celule Th17 care se infiltrează în țesuturi  . Împreună, aceste studii sugerează că RORgammat este un regulator cheie al homeostaziei imune și evidențiază potențialul său ca țintă terapeutică în bolile inflamatorii.

Specyficzna rekrutacja regulatorowych limfocytów T w raku jajnika sprzyja przywilejowi immunologicznemu i pozwala przewidzieć skrócenie czasu przeżycia.

 

T de reglementare (T (REG))  Celulele  mediază toleranță periferică homeostatic prin suprimarea T autoreactive  celule . Nerespectarea imunității antitumorale gazdă poate fi cauzată de supresia exagerată antigen reactive asociate tumorii  limfocite  mediate de T (REG)  celule ; Cu toate acestea, dovezi definitive care (REG) T  celule  au un rol imunopatologice in cancerul uman este lipsit. Aici ne arată, în studii detaliate ale CD4 (+) CD25 (+) FOXP3 (+) T (REG)  celule  in 104 persoane afectate cu carcinom ovarian, tumoarea umană T (REG)  celule  suprima T-tumorale specifice  celulei  imunitate și contribuie la creșterea tumorilor umane in vivo.

De asemenea, arătăm că celulele T (reg)  tumorale  sunt asociate cu un risc crescut de deces și supraviețuire redusă. Celulele T (reg)  umane  se deplasează și se acumulează preferențial în tumori și ascită, dar rareori intră în ganglionii limfatici care drenează în stadiile ulterioare ale cancerului.

Celulele tumorale   și macrofagele microambientale produc chemokina CCL22, care mediază traficul de celule T (reg)   către tumoră. Această recrutare specifică a celulelor T (reg)   reprezintă un mecanism prin care tumorile pot favoriza privilegiul imunitar. Astfel, blocarea  migrației sau funcției celulelor T (reg)  poate ajuta la înfrângerea cancerului uman.

Przywracanie funkcji wyczerpanych limfocytów T CD8 podczas przewlekłej infekcji wirusowej

Afectarea funcțională a celulelor T specifice antigenului   este o caracteristică definitorie a multor infecții cronice, dar mecanismele de bază ale  disfuncției celulelor T nu sunt bine înțelese. Pentru a rezolva această problemă, am analizat genele exprimate in afectarea useful virus-specific T CD8  celule  prezente la șoarecii infectați cronic cu virusul coriomeningitei limfocitare (LCMV) și a comparat aceste cu profilul genetic al T CD8 memorie functionale  celule .

Aici raportăm că PD-1 (moartea programată 1; cunoscut și sub numele de Pdcd1) a fost selectiv reglat în sus de celulele T epuizate și că administrarea in vivo a anticorpilor care a blocat interacțiunea acestui receptor inhibitor cu ligandul său, PD-L1 (cunoscut și ca B7-H1), a îmbunătățit  răspunsurile celulelor T.

In particular, am constatat ca , chiar si la soareci persistent infectate care au fost lipsite de celule CD4 T de celule de  ajutor, blocarea PD-1 / PD-L1 cale de inhibare a avut un efect benefic asupra „neajutorat“ T CD8  celule , restabilind capacitatea lor de a suferi proliferare , secretă citokine, ucid celulele infectate   și scad încărcătura virală. Blocarea căii inhibitoare a CTLA-4 ( proteina Four asociată cu limfocitele T citotoxice ) nu a avut niciun efect nici asupra  funcției celulelor T , nici asupra controlului viral. Aceste studii identifică un mecanism particular de  epuizare a celulelor T și definesc o strategie imunologică potențial eficientă pentru tratamentul infecțiilor virale cronice.

Human Granzyme A (GZMA) ELISA Kit
RD-GZMA-Hu-48Tests	Reddot Biotech	48 Tests	EUR 478

Human Granzyme A (GZMA) ELISA Kit
RD-GZMA-Hu-96Tests	Reddot Biotech	96 Tests	EUR 662

Human 293T Whole Cell Lysate
LYSATE0032	BosterBio	200ug	EUR 150
Description: This cell lysate is prepared from human 293T using Boster's RIPA Lysis Buffer (AR0105) using a standard whole cell lysate protocol. The concentration was determined using the BCA assay process and then diluted using Dithiothreitol (DTT) and a reducing SDS sample loading buffer, heated for 5 minutes at 100˚C.

Mouse Granzyme A (GZMA) ELISA Kit
DLR-GZMA-Mu-48T	DL Develop	48T	EUR 489
Should the Mouse Granzyme A (GZMA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Granzyme A (GZMA) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Mouse Granzyme A (GZMA) ELISA Kit
DLR-GZMA-Mu-96T	DL Develop	96T	EUR 635
Should the Mouse Granzyme A (GZMA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Granzyme A (GZMA) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Mouse Granzyme A (GZMA) ELISA Kit
RDR-GZMA-Mu-48Tests	Reddot Biotech	48 Tests	EUR 511

Mouse Granzyme A (GZMA) ELISA Kit
RDR-GZMA-Mu-96Tests	Reddot Biotech	96 Tests	EUR 709

Mouse Granzyme A (GZMA) ELISA Kit
RD-GZMA-Mu-48Tests	Reddot Biotech	48 Tests	EUR 489

Mouse Granzyme A (GZMA) ELISA Kit
RD-GZMA-Mu-96Tests	Reddot Biotech	96 Tests	EUR 677

AAVS1 Positive Control EGIP 293T Reporter Cell Line
CAS606A-1	SBI	1 Vial	EUR 807
Category: Cas9

Gene Knock-Out HR Targeting Vector [MCS1-EF1?-RFP-T2A-Puro-pA-MCS2]
HR110PA-1	SBI	10 ug	EUR 1023
Category: HR Donors

Gene Knock-Out HR Targeting Vector [MCS1-EF1a-GFP-T2A-Puro-pA-MCS2]
HR410PA-1	SBI	10 ug	EUR 1023
Category: HR Donors

Gene Knock-Out HR Targeting Vector [MCS1-EF1a-RFP-T2A-Hygro-pA-MCS2]
HR510PA-1	SBI	10 ug	EUR 1023
Category: HR Donors

TARGATT? Knock-in iPSC Generation (Master Cell Line)
AST-1100	Applied StemCell	1 vial of 1X10^6 cells	Ask for price
Description: 6 month

TARGATT? Knock-in Mouse Cell Line Generation Kit (Master Cell Line)
AST-7001	Applied StemCell	1 Kit	Ask for price
Description: 6 month

HEK-293T cells
T0011002	Addexbio	One Frozen vial	EUR 455

TARGATT? Knock-in CHO Generation Kit (Master Cell Line)
AST-1200	Applied StemCell	1 Kit	Ask for price
Description: 12 month

TARGATT? Knock-in HEK293 Generation Kit (Master Cell Line)
AST-1300	Applied StemCell	1 Kit	Ask for price
Description: 12 month

Gzma 3'UTR Luciferase Stable Cell Line
TU109260	ABM	1.0 ml	Ask for price

Gzma 3'UTR Luciferase Stable Cell Line
TU205597	ABM	1.0 ml	Ask for price

Gzma 3'UTR GFP Stable Cell Line
TU159260	ABM	1.0 ml	Ask for price

Gzma 3'UTR GFP Stable Cell Line
TU255597	ABM	1.0 ml	Ask for price

GZMA 3'UTR GFP Stable Cell Line
TU059495	ABM	1.0 ml	EUR 1394

GZMA 3'UTR Luciferase Stable Cell Line
TU009495	ABM	1.0 ml	EUR 1394

HEK-293T Telomerase Over-Expressing Cell Pellet
abx069991-1Pellet	Abbexa	1 Pellet	EUR 398
Shipped within 1-3 working days.

Basic HR Targeting Vector [MCS1-LoxP-MCS2-MCS3-pA-LoxP-MCS4] for Gene Knock-In/Out
HR100PA-1	SBI	10 ug	EUR 938
Category: HR Donors

293AD Cell Line
AD-100	Cell Biolabs	1 vial	EUR 461
Description: The 293AD Cell Line is derived from the parental 293 cells but selected for attributes that increase adenovirus production, including firmer attachment and larger surface area.

293AAV Cell Line
AAV-100	Cell Biolabs	1 vial	EUR 508
Description: The 293AAV Cell Line is derived from the parental 293 cells but selected for attributes that increase AAV production, including firmer attachment and larger surface area.

293LTV Cell Line
LTV-100	Cell Biolabs	1 vial	EUR 508
Description: The 293LTV Cell Line is derived from the parental 293 cells but selected for attributes that increase lentiviral production, including fimrer attachment and larger surface area.

293RTV Cell Line
RV-100	Cell Biolabs	1 vial	EUR 508
Description: The 293RTV Cell Line is derived from the parental 293 cells but selected for attributes that increase retroviral production, including fimrer attachment and larger surface area.

Microplate Swing-Out Centrifuge
abx725026-1Unit	Abbexa	1 Unit	EUR 1476
Shipped within 10-15 working days.

Clinical Swing-Out Centrifuge
abx725027-1Unit	Abbexa	1 Unit	EUR 1476
Shipped within 10-15 working days.

Gene Knock-Out HR Targeting Vector w/Single Selection Marker (Blasticidin) and Negative Selection (TK) Against Random Integration
HR720PA-1	SBI	10 µg	EUR 1145
Category: HR Donors

293T Transfection Kit (1 mL)
P902	101Bio	NULL	EUR 0

293T Transfection Kit (0.2 mL)
P902S	101Bio	NULL	EUR 0

293T Transfection Kit (1 mL)
P903	101Bio	NULL	EUR 0

293T Transfection Kit (0.2 mL)
P903S	101Bio	NULL	EUR 0

293/GFP Cell Line
AKR-200	Cell Biolabs	1 vial	EUR 572
Description: 293/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.

T47D/GFP Cell Line
AKR-208	Cell Biolabs	1 vial	EUR 572
Description: T47D/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.

A549/GFP Cell Line
AKR-209	Cell Biolabs	1 vial	EUR 572
Description: A549/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.

HeLa/GFP Cell Line
AKR-213	Cell Biolabs	1 vial	EUR 572
Description: HeLa/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.

NIH3T3/GFP Cell Line
AKR-214	Cell Biolabs	1 vial	EUR 572
Description: NIH3T3/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.

NIH3T3/Cas9 Cell Line
AKR-5104	Cell Biolabs	1 vial	EUR 572

293/Cas9 Cell Line
AKR-5110	Cell Biolabs	1 vial	EUR 572

HeLa/Cas9 Cell Line
AKR-5111	Cell Biolabs	1 vial	EUR 572

GZMA antibody
70R-17667	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal GZMA antibody

GZMA Antibody
DF9054	Affbiotech	200ul	EUR 304
Description: GZMA Antibody detects endogenous levels of total GZMA.

GZMA antibody
70R-9289	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal GZMA antibody

GZMA Antibody
1-CSB-PA009084	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GZMA. Recognizes GZMA from Human. This antibody is Unconjugated. Tested in the following application: IHC, IF, ELISA;IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

GZMA Antibody
1-CSB-PA010081ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GZMA. Recognizes GZMA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

GZMA Antibody
1-CSB-PA010081GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GZMA. Recognizes GZMA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Gzma Antibody
1-CSB-PA010081LA01MO	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Gzma. Recognizes Gzma from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

GZMA siRNA
20-abx918982	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GZMA siRNA
20-abx918983	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GZMA Antibody
ABD9054	Lifescience Market	100 ug	EUR 438

Gene Knock-Out HR Targeting Vector w/Dual Selection Markers (GFP+Puro) and Negative Selection (TK) Against Random Integration
HR700PA-1	SBI	10 µg	EUR 1145
Category: HR Donors

Gene Knock-Out HR Targeting Vector w/Dual Selection Markers (RFP+Hygro) and Negative Selection (TK) Against Random Integration
HR710PA-1	SBI	10 µg	EUR 1145
Category: HR Donors

GZMA sgRNA CRISPR Lentivector set (Human)
K0923801	ABM	3 x 1.0 ug	EUR 339

SKOV-3/Luc Cell Line
AKR-232	Cell Biolabs	1 vial	EUR 572
Description: SKOV-3/Luc Cell Line stably expresses luciferase and otherwise exhibits the same characteristics of the parental cell line.

MCF-7/Luc Cell Line
AKR-234	Cell Biolabs	1 vial	EUR 572
Description: MCF-7/Luc Cell Line stably expresses luciferase and otherwise exhibits the same characteristics of the parental cell line.

OVCAR-5/RFP Cell Line
AKR-254	Cell Biolabs	1 vial	EUR 572
Description: OVCAR-5/RFP Cell Line stably expresses RFP and otherwise exhibits the same characteristics of the parental cell line.

Human GZMA ELISA Kit
ELA-E0599h	Lifescience Market	96 Tests	EUR 824

GZMA ELISA KIT|Human
EF000669	Lifescience Market	96 Tests	EUR 689

Human GZMA shRNA Plasmid
20-abx952036	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

GZMA Recombinant Protein (Human)
RP014302	ABM	100 ug	Ask for price

Gene Knock-Out HR Targeting Vector with TK selection [MCS1-LoxP-EF1?-GFP-T2A-Puro-P2A-hsvTK-pA-LoxP-MCS2]
HR210PA-1	SBI	10 ug	EUR 1145
Category: HR Donors

GZMA sgRNA CRISPR Lentivector (Human) (Target 1)
K0923802	ABM	1.0 ug DNA	EUR 154

GZMA sgRNA CRISPR Lentivector (Human) (Target 2)
K0923803	ABM	1.0 ug DNA	EUR 154

GZMA sgRNA CRISPR Lentivector (Human) (Target 3)
K0923804	ABM	1.0 ug DNA	EUR 154

Platinum-E Retroviral Packaging Cell Line, Ecotropic
RV-101	Cell Biolabs	1 vial	EUR 920
Description: Conventional cells used for retrovirus packaging, such as those based on NIH3T3 cells, have limited stability and produce relatively low yields of retrovirus, mainly due to the poor expression of retroviral structure proteins (gag, pol and env) in the cells. The Platinum Retroviral Packaging Cell Lines are based on the 293T cell line. They exhibit longer stability and produce higher yields of retroviral structure proteins. Plat-E cells contain gag, pol and env genes, allowing retroviral packaging with a single plasmid transfection.

Platinum-A Retroviral Packaging Cell Line, Amphotropic
RV-102	Cell Biolabs	1 vial	EUR 920
Description: Conventional cells used for retrovirus packaging, such as those based on NIH3T3 cells, have limited stability and produce relatively low yields of retrovirus, mainly due to the poor expression of retroviral structure proteins (gag, pol and env) in the cells. The Platinum Retroviral Packaging Cell Lines are based on the 293T cell line. They exhibit longer stability and produce higher yields of retroviral structure proteins. Plat-A cells contain gag, pol and env genes, allowing retroviral packaging with a single plasmid transfection.

Platinum-GP Retroviral Packaging Cell Line, Pantropic
RV-103	Cell Biolabs	1 vial	EUR 920
Description: Conventional cells used for retrovirus packaging, such as those based on NIH3T3 cells, have limited stability and produce relatively low yields of retrovirus, mainly due to the poor expression of retroviral structure proteins (gag, pol and env) in the cells. The Platinum Retroviral Packaging Cell Lines are based on the 293T cell line. They exhibit longer stability and produce higher yields of retroviral structure proteins. Plat-GP cells contain the gag and pol genes required for retroviral packaging; an expression vector is co-transfected with a VSVG envelope vector.

GZMA Blocking Peptide
33R-5360	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GZMA antibody, catalog no. 70R-9289

GZMA Polyclonal Antibody
42195-100ul	SAB	100ul	EUR 333

GZMA Blocking Peptide
DF9054-BP	Affbiotech	1mg	EUR 195

GZMA cloning plasmid
CSB-CL010081HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 789 Sequence: atgaggaactcctatagatttctggcatcctctctctcagttgtcgtttctctcctgctaattcctgaagatgtctgtgaaaaaattattggaggaaatgaagtaactcctcattcaagaccctacatggtcctacttagtcttgacagaaaaaccatctgtgctggggctttgat Show more
Description: A cloning plasmid for the GZMA gene.

Gzma Polyclonal Antibody
A59334	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

GZMA Rabbit pAb
A6231-100ul	Abclonal	100 ul	EUR 308

GZMA Rabbit pAb
A6231-200ul	Abclonal	200 ul	EUR 459

GZMA Rabbit pAb
A6231-20ul	Abclonal	20 ul	EUR 183

GZMA Rabbit pAb
A6231-50ul	Abclonal	50 ul	EUR 223

Anti-GZMA antibody
STJ27987	St John's Laboratory	100 µl	EUR 277
Description: Cytolytic T lymphocytes (CTL) and natural killer (NK) cells share the remarkable ability to recognize, bind, and lyse specific target cells. They are thought to protect their host by lysing cells bearing on their surface 'nonself' antigens, usually peptides or proteins resulting from infection by intracellular pathogens. The protein described here is a T cell- and natural killer cell-specific serine protease that may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells.

Anti-GZMA antibody
STJ71899	St John's Laboratory	100 µg	EUR 260

Anti-GZMA (4C6)
YF-MA20335	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to GZMA

TARGATT? Knock-in iPSC Genotyping Kit
AST-1102	Applied StemCell	1 Kit	Ask for price
Description: 12 month

Human Granzyme A (GZMA) Protein
20-abx653630	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Human Granzyme A (GZMA) Protein
20-abx653632	Abbexa	EUR 885.00 EUR 328.00 EUR 2834.00 EUR 1052.00 EUR 606.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Human Granzyme A (GZMA) Protein
20-abx651491	Abbexa	EUR 732.00 EUR 286.00 EUR 2305.00 EUR 885.00 EUR 523.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

GZMA ORF Vector (Human) (pORF)
ORF004768	ABM	1.0 ug DNA	EUR 95

GZMA ELISA Kit (Human) (OKAN05337)
OKAN05337	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: Cytolytic T lymphocytes (CTL) and natural killer (NK) cells share the remarkable ability to recognize, bind, and lyse specific target cells. They are thought to protect their host by lysing cells bearing on their surface 'nonself' antigens, usually peptides or proteins resulting from infection by intracellular pathogens. The protein described here is a T cell- and natural killer cell-specific serine protease that may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.055 ng/mL

GZMA ELISA Kit (Human) (OKBB00906)
OKBB00906	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: Granzyme A is a protein that in humans is encoded by the GZMA gene. Cytolytic T lymphocytes (CTL) and natural killer (NK) cells share the remarkable ability to recognize, bind, and lyse specific target cells. They are thought to protect their host by lysing cells bearing on their surface "nonself" antigens, usually peptides or proteins resulting from infection by intracellular pathogens. The protein described here is a T cell- and natural killer cell-specific serine protease that may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells. GZMA induces caspase-independent apoptosis in a characteristic manner, except it causes a distinctive form of DNA damage: single-stranded DNA nicking. A target of GZMA is the SET complex, including HMGB2 and ANP32A.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

GZMA ELISA Kit (Human) (OKCD05260)
OKCD05260	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: Cytolytic T lymphocytes (CTL) and natural killer (NK) cells share the remarkable ability to recognize, bind, and lyse specific target cells. They are thought to protect their host by lysing cells bearing on their surface 'nonself' antigens, usually peptides or proteins resulting from infection by intracellular pathogens. The protein described here is a T cell- and natural killer cell-specific serine protease that may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells. Cytolytic T lymphocytes (CTL) and natural killer (NK) cells share the remarkable ability to recognize, bind, and lyse specific target cells. They are thought to protect their host by lysing cells bearing on their surface 'nonself' antigens, usually peptides or proteins resulting from infection by intracellular pathogens. The protein described here is a T cell- and natural killer cell-specific serine protease that may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Entrez Gene record to access additional publications.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 5.7pg/mL

GZMA ELISA Kit (Human) (OKCD06562)
OKCD06562	Aviva Systems Biology	96 Wells	EUR 753
Description: Description of target: Cytolytic T lymphocytes (CTL) and natural killer (NK) cells share the remarkable ability to recognize, bind, and lyse specific target cells. They are thought to protect their host by lysing cells bearing on their surface 'nonself' antigens, usually peptides or proteins resulting from infection by intracellular pathogens. The protein described here is a T cell- and natural killer cell-specific serine protease that may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells. Cytolytic T lymphocytes (CTL) and natural killer (NK) cells share the remarkable ability to recognize, bind, and lyse specific target cells. They are thought to protect their host by lysing cells bearing on their surface 'nonself' antigens, usually peptides or proteins resulting from infection by intracellular pathogens. The protein described here is a T cell- and natural killer cell-specific serine protease that may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Entrez Gene record to access additional publications.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.055ng/mL

PinPoint-FC 293T Platform Cell Line for Targeted Gene Insertion (with PinPoint site already placed)
PIN320A-1	SBI	>2x10^5 cells	EUR 3104
Category: PinPoint Integrase Tools

Total Protein - Murine Embryonic Stem Cell Line D3
CBA-305	Cell Biolabs	500 ?g	EUR 345
Description: Isolated from mouse ES-D3 cell line Presented as 500 µg at 1 mg/mL in NP-40 Solubilization Buffer

Gzma sgRNA CRISPR Lentivector set (Rat)
K7364801	ABM	3 x 1.0 ug	EUR 339

Gzma sgRNA CRISPR Lentivector set (Mouse)
K3890501	ABM	3 x 1.0 ug	EUR 339

TARGATT? Knock-in iPSC Quick Knockin Kit
AST-1101	Applied StemCell	1 Kit	Ask for price
Description: 12 month

Mouse Granzyme A (Gzma)
1-CSB-EP010081MO	Cusabio	EUR 505.00 EUR 265.00 EUR 1827.00 EUR 766.00 EUR 1218.00 EUR 335.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 39.6 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Granzyme A(Gzma) expressed in E.coli

Mouse Granzyme A (Gzma)
1-CSB-EP010081MOa0	Cusabio	EUR 505.00 EUR 265.00 EUR 1827.00 EUR 766.00 EUR 1218.00 EUR 335.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 31.6 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Granzyme A(Gzma) expressed in E.coli

Granzyme A (GZMA) Antibody
20-abx006330	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Granzyme A (GZMA) Antibody
20-abx176698	Abbexa	EUR 398.00 EUR 133.00 EUR 1094.00 EUR 537.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Granzyme A (GZMA) Antibody
20-abx176699	Abbexa	EUR 398.00 EUR 133.00 EUR 1094.00 EUR 537.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Granzyme A (GZMA) Antibody
20-abx176701	Abbexa	EUR 1135.00 EUR 551.00	1 mg 200 ug
Please enquire.

Granzyme A (GZMA) Antibody
20-abx100560	Abbexa	EUR 411.00 EUR 133.00 EUR 1135.00 EUR 551.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Granzyme A (GZMA) Antibody
20-abx112843	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Granzyme A (GZMA) Antibody
abx122954-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Granzyme A (GZMA) Antibody
20-abx128528	Abbexa	EUR 398.00 EUR 133.00 EUR 1094.00 EUR 537.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

GZMA Polyclonal Conjugated Antibody
C42195	SAB	100ul	EUR 397

Gzma Antibody, HRP conjugated
1-CSB-PA010081LB01MO	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Gzma. Recognizes Gzma from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA

Gzma Antibody, FITC conjugated
1-CSB-PA010081LC01MO	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Gzma. Recognizes Gzma from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA

Gzma Antibody, Biotin conjugated
1-CSB-PA010081LD01MO	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Gzma. Recognizes Gzma from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA

Granzyme A (Gzma) Antibody
20-abx319042	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Granzyme A (GZMA) Antibody
20-abx320202	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Granzyme A (GZMA) Antibody
abx233633-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Granzyme A (GZMA) Antibody
20-abx323175	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Granzyme A (GZMA) Antibody
abx432781-200ul	Abbexa	200 ul	EUR 286
Shipped within 1-3 working days.

Mouse GZMA shRNA Plasmid
20-abx970717	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Eukaryotic Granzyme A (GZMA)
4-EPA599Hu51	Cloud-Clone	EUR 530.08 EUR 245.00 EUR 1712.80 EUR 637.60 EUR 1175.20 EUR 418.00 EUR 4132.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P12544 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 28.2kDa Isoelectric Point: 9.2
Description: Recombinant Human Granzyme A expressed in: Yeast

Recombinant Granzyme A (GZMA)
4-RPA599Mu01	Cloud-Clone	EUR 548.00 EUR 250.00 EUR 1780.00 EUR 660.00 EUR 1220.00 EUR 430.00 EUR 4300.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P11032 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 26.9kDa Isoelectric Point: 9.4
Description: Recombinant Mouse Granzyme A expressed in: E.coli

GZMA Recombinant Protein (Rat)
RP204086	ABM	100 ug	Ask for price

GZMA Recombinant Protein (Mouse)
RP140609	ABM	100 ug	Ask for price

Human Granzyme A (GZMA) ELISA Kit
20-abx151729	Abbexa	EUR 6642.00 EUR 3542.00 EUR 825.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Granzyme A (GZMA) ELISA Kit
abx253929-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Human GZMA/ Granzyme A ELISA Kit
E1079Hu	Sunlong	1 Kit	EUR 571

Human GZMA(Granzyme A) ELISA Kit
EH0974	FN Test	96T	EUR 524.1
Detection range: 15.625-1000 pg/ml Uniprot ID: P12544 Alias: GZMA(Granzyme A)/CTL Tryptase/CTLA3/Fragmentin-1/HF/HFSP/Cytotoxic T-lymphocyte proteinase 1/Granzyme-1/H factor/Hanukkah factor
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml

Human Granzyme A, GZMA ELISA KIT
ELI-02157h	Lifescience Market	96 Tests	EUR 824

Human granzyme A (GZMA) ELISA Kit
CSB-E08715h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human granzyme A (GZMA) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human granzyme A (GZMA) ELISA Kit
1-CSB-E08715h	Cusabio	EUR 900.00 EUR 5476.00 EUR 2900.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human granzyme A (GZMA) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Granzyme A (GZMA) ELISA Kit
abx571746-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Human Granzyme A (GZMA) Protein (Active)
20-abx655652	Abbexa	EUR 1191.00 EUR 425.00 EUR 4017.00 EUR 1455.00 EUR 815.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Human Granzyme A (GZMA) ELISA Kit
20-abx585052	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Granzyme A (GZMA) CLIA Kit
20-abx491735	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Granzyme A (GZMA) CLIA Kit
20-abx496426	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Granzyme A ELISA Kit (GZMA)
RK01528	Abclonal	96 Tests	EUR 521

Human Granzyme A (GZMA) ELISA Kit
SEA599Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4273.35
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme A (GZMA) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme A (GZMA) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Granzyme A (GZMA) ELISA Kit
SEA599Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 439.57
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme A (GZMA) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme A (GZMA) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Granzyme A (GZMA) ELISA Kit
SEA599Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 585.1
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme A (GZMA) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme A (GZMA) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Granzyme A (GZMA) ELISA Kit
SEA599Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2332.95
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme A (GZMA) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme A (GZMA) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Granzyme A (GZMA) ELISA Kit
4-SEA599Hu	Cloud-Clone	EUR 4324.00 EUR 2283.00 EUR 586.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Granzyme A elisa. Alternative names of the recognized antigen: CTLA3 HFSP HF H factor Granzyme 1 Fragmentin-1 Hanukkah factor Cytotoxic T-Lymphocyte-Associated Serine Esterase 3 CTL tryptase Cytotoxic T-lymphocyte proteinase 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Granzyme A (GZMA) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

HBS w/out Phenol Red, 500 ml
409	AthenaES	500 ml	EUR 72

Out At First Protein Homolog (OAF) Antibody
abx027798-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Out At First Protein Homolog (OAF) Antibody
abx027798-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Out At First Protein Homolog (OAF) Antibody
abx146027-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Gzma sgRNA CRISPR Lentivector (Rat) (Target 1)
K7364802	ABM	1.0 ug DNA	EUR 154

Gzma sgRNA CRISPR Lentivector (Rat) (Target 2)
K7364803	ABM	1.0 ug DNA	EUR 154

Gzma sgRNA CRISPR Lentivector (Rat) (Target 3)
K7364804	ABM	1.0 ug DNA	EUR 154

Gzma sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3890502	ABM	1.0 ug DNA	EUR 154

Gzma sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3890503	ABM	1.0 ug DNA	EUR 154

Gzma sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3890504	ABM	1.0 ug DNA	EUR 154

ELISA kit for Human GzmA (Granzyme A)
E-EL-H1616	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's GzmA ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human GzmA. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human GzmA (Granzyme A) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human GZMA (Granzyme A)
ELK4608	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Granzyme A (GZMA). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Granzyme A (GZMA Show more
Description: A sandwich ELISA kit for detection of Granzyme A from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Granzyme A (GZMA) Polyclonal Antibody (Human, Mouse)
4-PAA599Mu01	Cloud-Clone	EUR 236.00 EUR 2338.00 EUR 586.00 EUR 294.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GZMA (Ile29~Val260) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Granzyme A (GZMA)

GZMA Protein Vector (Human) (pPB-C-His)
PV019069	ABM	500 ng	EUR 329

GZMA Protein Vector (Human) (pPB-N-His)
PV019070	ABM	500 ng	EUR 329

GZMA Protein Vector (Human) (pPM-C-HA)
PV019071	ABM	500 ng	EUR 329

GZMA Protein Vector (Human) (pPM-C-His)
PV019072	ABM	500 ng	EUR 329

GZMA ELISA Kit (Human) : 96 Wells (OKEH02762)
OKEH02762	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Cytolytic T lymphocytes (CTL) and natural killer (NK) cells share the remarkable ability to recognize, bind, and lyse specific target cells. They are thought to protect their host by lysing cells bearing on their surface 'nonself' antigens, usually peptides or proteins resulting from infection by intracellular pathogens. The protein described here is a T cell- and natural killer cell-specific serine protease that may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.1 ng/mL

Polyclonal GZMA Antibody (internal region)
APG00588G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human GZMA (internal region). This antibody is tested and proven to work in the following applications:

Granzyme A (GZMA) Antibody (APC)
20-abx176700	Abbexa	EUR 1094.00 EUR 537.00	1 mg 200 ug
Please enquire.

Mouse Granzyme A (GZMA) Protein
20-abx167506	Abbexa	EUR 759.00 EUR 300.00 EUR 2388.00 EUR 913.00 EUR 537.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Granzyme A (GZMA) Antibody (Biotin)
20-abx270997	Abbexa	EUR 425.00 EUR 230.00 EUR 1219.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Granzyme A (Gzma) Antibody (HRP)
20-abx319043	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Granzyme A (Gzma) Antibody (FITC)
20-abx319044	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Granzyme A (Gzma) Antibody (Biotin)
20-abx319045	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Granzyme A (GZMA) Antibody Pair
20-abx370633	Abbexa	EUR 1595.00 EUR 1024.00	10 × 96 tests 5 × 96 tests
Shipped within 5-15 working days.

Gzma Polyclonal Antibody, Biotin Conjugated
A59335	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

Gzma Polyclonal Antibody, FITC Conjugated
A59336	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

Gzma Polyclonal Antibody, HRP Conjugated
A59337	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

Anti-Granzyme A/GZMA Antibody
PA1588	BosterBio	100ug/vial	EUR 334

Gzma ORF Vector (Rat) (pORF)
ORF068030	ABM	1.0 ug DNA	EUR 506

Gzma ORF Vector (Mouse) (pORF)
ORF046871	ABM	1.0 ug DNA	EUR 506

GZMA ELISA Kit (Mouse) (OKCD02583)
OKCD02583	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: Abundant protease in the cytosolic granules of cytotoxic T-cells and NK-cells which activates caspase-independent cell death with morphological features of apoptosis when delivered into the target cell through the immunological synapse. It cleaves after Lys or Arg. Cleaves APEX1 after 'Lys-31' and destroys its oxidative repair activity. Cleaves the nucleosome assembly protein SET after 'Lys-189', which disrupts its nucleosome assembly activity and allows the SET complex to translocate into the nucleus to nick and degrade the DNA. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 35 pg/mL

GZMA ELISA Kit (Bovine) (OKEH06598)
OKEH06598	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: Abundant protease in the cytosolic granules of cytotoxic T-cells and NK-cells which activates caspase-independent cell death with morphological features of apoptosis when delivered into the target cell through the immunological synapse. It cleaves after Lys or Arg. Cleaves APEX1 after 'Lys-31' and destroys its oxidative repair activity. Cleaves the nucleosome assembly protein SET after 'Lys-189', which disrupts its nucleosome assembly activity and allows the SET complex to translocate into the nucleus to nick and degrade the DNA.;Species reactivity: Bovine;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.05 ng/mL

GZMA ELISA Kit (Rat) (OKEI00778)
OKEI00778	Aviva Systems Biology	96 Wells	EUR 767
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.938 ng/mL

Human OAF (Out at first protein homolog) ELISA Kit (CUSTOM)
ELI-38218h	Lifescience Market	96 Tests	EUR 824

EtB Out Nucleic Acid Staining Solution20,000 x RoomTemperature
FYD007-200P	Yeastern Biotech	200 Preps, 1 ml	Ask for price

GZMA sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0923805	ABM	3 x 1.0 ug	EUR 376

CytoSelect Cell Transformation Assay (Cell Recovery Compatible), Colorimetric
CBA-135	Cell Biolabs	96 assays	EUR 821
Description: CytoSelect 96-Well Cell Transformation Assays (Cell Recovery Compatible) provide a robust system for detecting transformed cells, screening cell transformation inhibitors, and determining in vitro drug sensitivity. A proprietary modified soft agar matrix allows you to either quantify cells using the included fluorescent dye, or recover the cells for further analysis.

CytoSelect Cell Transformation Assay (Cell Recovery Compatible), Colorimetric
CBA-135-5	Cell Biolabs	5 x 96 assays	EUR 3356
Description: CytoSelect 96-Well Cell Transformation Assays (Cell Recovery Compatible) provide a robust system for detecting transformed cells, screening cell transformation inhibitors, and determining in vitro drug sensitivity. A proprietary modified soft agar matrix allows you to either quantify cells using the included fluorescent dye, or recover the cells for further analysis.

CytoSelect Cell Transformation Assay (Cell Recovery Compatible), Fluorometric
CBA-140	Cell Biolabs	96 assays	EUR 856
Description: CytoSelect 96-Well Cell Transformation Assays (Cell Recovery Compatible) provide a robust system for detecting transformed cells, screening cell transformation inhibitors, and determining in vitro drug sensitivity. A proprietary modified soft agar matrix allows you to either quantify cells using the included fluorescent dye, or recover the cells for further analysis.

CytoSelect Cell Transformation Assay (Cell Recovery Compatible), Fluorometric
CBA-140-5	Cell Biolabs	5 x 96 assays	EUR 3483
Description: CytoSelect 96-Well Cell Transformation Assays (Cell Recovery Compatible) provide a robust system for detecting transformed cells, screening cell transformation inhibitors, and determining in vitro drug sensitivity. A proprietary modified soft agar matrix allows you to either quantify cells using the included fluorescent dye, or recover the cells for further analysis.

StemTAG Stem Cell Colony Formation Assay (Cell Recovery Compatible)
CBA-325	Cell Biolabs	96 assays	EUR 856
Description: Our StemTAG 96-Well Stem Cell Colony Formation Assay provides a high-throughput method to quantify ES cells in just 7-10 days, and no manual cell counting is required. Once colonies are formed, they may be analyzed in three different ways: 1. Lyse cells, then quantify in a fluorescence plate reader using dye included in the kit; 2. Lyse cells, then quantify alkaline phosphatase activity using reagents provided; or 3. Recover colonies from matrix for further culture or analysis.

StemTAG Stem Cell Colony Formation Assay (Cell Recovery Compatible)
CBA-325-5	Cell Biolabs	5 x 96 assays	EUR 3361
Description: Our StemTAG 96-Well Stem Cell Colony Formation Assay provides a high-throughput method to quantify ES cells in just 7-10 days, and no manual cell counting is required. Once colonies are formed, they may be analyzed in three different ways: 1. Lyse cells, then quantify in a fluorescence plate reader using dye included in the kit; 2. Lyse cells, then quantify alkaline phosphatase activity using reagents provided; or 3. Recover colonies from matrix for further culture or analysis.

ROTOR, 6 X 5ML SWING-OUT ROTOR,1/CS
480138	CORNING	1/pk	EUR 538
Description: Lab Equipment; General Purpose Centrifuges (affliated brand)

PIPET CONTROLLER - UNIVERSAL POWER SUPPLY IN:100-250V, OUT:
357489	CORNING	1/pk	EUR 58
Description: Falcon Liquid Handling Equipment; Falcon Pipet Controllers and Accessories

Chicken Out at first protein homolog, oaf ELISA KIT
ELI-13285c	Lifescience Market	96 Tests	EUR 928

Rat Out at first protein homolog, Oaf ELISA KIT
ELI-15146r	Lifescience Market	96 Tests	EUR 886

Rat Out at first protein homolog (OAF) ELISA Kit
abx391739-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Out at first protein homolog (OAF) ELISA Kit
abx390101-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.