
Wykrywanie i izolacja cząstek retrowirusa typu C ze świeżych i hodowanych


Wykrywanie i izolacja cząstek retrowirusa typu C ze świeżych i hodowanych limfocytów pacjenta ze skórnym chłoniakiem T-komórkowym.

 Particule de retrovirus cu morfologie de tip C au fost găsite în două  linii celulare  limfoblastoidiene de celule T  , HUT 102 și CTCL-3, și în limfocite proaspete de sânge periferic   obținute de la un pacient cu limfom cutanat cu celule  T (micoză fungoidă). Liniile  celulare  produc continuu aceste virusuri, care sunt denumite în mod colectiv HTLV, tulpina CR (HTLV (CR)).

Inițial, producția de virus din celulele HUT 102 a   necesitat inducerea cu 5-iodo-2′-deoxiuridină, dar   linia celulară a devenit un producător constitutiv de virus la pasajul 56.  Linia celulară CTCL-Three a fost un producător constitutiv de virus de la al doilea pasaj în cultură.

Ambele particule de virus ular celular additional matur și imatur au fost observate în micrografii electronice cu secțiune subțire de materials ular repair cu celule peletate  ; ocazional, s-au văzut particule tipice de virus în devenire de tip C. Nu s-a văzut nicio formă de particulă de virus ular intra celular .

Particulele mature aveau un diametru de 100-110 nm, constau dintr-un miez dens de electroni înconjurat de o membrană exterioară separată de o regiune electron-lucentă, bandată la o densitate de 1,16 g / ml pe un gradient continuu de zaharoză de 25-65% și conținea ARN 70S și o activitate ADN polimerază tipică pentru transcriptaza inversă virală (RT; ADN nucleotidiltransferază dependentă de ARN). În anumite condiții de testare, HTLV (CR) RT a arătat preferința cationică pentru Mg (2+) față de Mn (2+), distinctă de caracteristicile ADN polimeraze celulare ular purificate din limfocite umane  și RT din majoritatea virusurilor de tip C.

Anticorpii împotriva  ADN polimerazei ular celulare gamma și anticorpilor împotriva RT purificați din mai multe retrovirusuri animale nu au reușit să interacționeze detectabil cu HTLV (CR) RT în condiții pozitive pentru ADN polimeraza omologă respectivă, demonstrând lipsa unei relații strânse de HTLV ) RT la  ADN polimeraze celulare ular gamma sau RT ale acestor virusuri. Șase proteine ​​majore, cu dimensiuni de aproximativ 10.000, 13.000, 19.000, 24.000, 42.000 și 52.000 daltoni, au fost evidente atunci când particulele HTLV (CR) dublu bandate și perturbate au fost cromatografiate pe o NaDodSO (4) / poliacrilamidăgel. Numărul acestor proteine ​​asociate particulelor este în concordanță cu proteinele așteptate ale unui retrovirus, dar dimensiunile unora sunt diferite de cele ale celor mai cunoscute retrovirusuri ale subgrupurilor de primate.

Izolacja retrowirusa limfotropowego T od pacjenta z ryzykiem zespołu nabytego niedoboru odporności (AIDS).

Un retrovirus aparținând familiei  virusurilor leucemice cu celule T umane (HTLV) current descoperite , dar clar distinct de fiecare izolat anterior, a fost izolat de la un pacient caucazian cu semne și simptome care preced adesea sindromului imunodeficienței dobândite (SIDA). Acest virus este un virus tumoral tipic ARN tip C, muguri din   membrana celulară , preferă magneziul pentru activitatea de transcriptază inversă și are un antigen intern (p25) comparable cu HTLV p24.

Anticorpii din serul acestui pacient reacționează cu proteinele din virusurile subgrupului HTLV-I, dar antiserurile de tip particular la HTLV-I nu precipită proteinele noului izolat. Virusul de la acest pacient a fost transmis în limfocitele din sângele cordonului ombilical  , iar virusul produs de aceste  celule  este comparable cu izolatul unique. Din aceste studii se concluzionează că acest virus, precum și izolatele anterioare HTLV aparțin unei familii generale de retrovirusuri T-limfotrope care se transmit orizontal la om și pot fi implicate în mai multe sindroame patologice, inclusiv SIDA.



Zaangażowanie imunoinhibitorowego receptora PD-1 przez nowego członka rodziny B7 prowadzi do negatywnej regulacji aktywacji limfocytów. 

PD-1 este un receptor imunoinhibitor exprimat de celule T activate  , celule B  și celule mieloide  . Șoarecii deficienți în PD-1 prezintă o defalcare a toleranței periferice și demonstrează a number of caracteristici autoimune. Raportăm aici că ligandul PD-1 (PD-L1) este un membru al familiei genelor B7. Angajarea PD-1 de către PD-L1 duce la inhibarea  proliferării limfocitelor  mediate de receptorul  celulelor T  și a secreției de citokine. În plus, semnalizarea PD-1 poate inhiba cel puțin niveluri suboptimale de costimulare mediată de CD28. PD-L1 este exprimat de celule care prezintă antigen  , inclusiv monocite de sânge periferic uman stimulate cu interferon gamma și dendritic uman și murin activat celule .

În plus, PD-L1 este exprimat în țesuturi nelimfoide, cum ar fi inima și plămânii. Nivelurile relative de inhibare a PD-L1 și costimulare B7-1 / B7-2 semnalelor pe prezentatoare de antigen  celule  poate determina gradul de T  cu celule de  activare și , prin urmare , pragul dintre toleranță și autoimunitate. Expresia PD-L1 pe țesuturile nelimfoide și interacțiunea sa potențială cu PD-1 pot determina ulterior amploarea răspunsurilor imune la locurile de inflamație.

U myszy z niedoborem interleukiny 10 rozwija się przewlekłe zapalenie jelit.

Interleukina-10 (IL-10) afectează creșterea și diferențierea multor celule hemopoietice   in vitro; în particular, este un puternic supresor al  funcțiilor macrofagelor și celulelor T. La șoarecii cu deficiență de IL-10, generați prin direcționarea genelor,   dezvoltarea limfocitelor și răspunsurile la anticorpi sunt normale, dar majoritatea animalelor sunt retardate în creștere și anemice și suferă de enterocolită cronică. Modificările intestinului includ hiperplazie mucoasă extinsă, reacții inflamatorii și expresia aberantă a moleculelor majore de complicated de histocompatibilitate clasa II pe epitelii.

În schimb, mutanții păstrați în condiții specifice fără patogeni dezvoltă doar o inflamație locală limitată la colonul proximal. Aceste rezultate indică faptul că inflamația intestinului la mutanți provine din răspunsuri imune necontrolate stimulate de antigeni enterici și că IL-10 este un imunoreglator esențial în tractul intestinal.

Prosta technika ilościowego określania niskich poziomów uszkodzeń DNA w poszczególnych komórkach.

Limfocitele umane   au fost fie expuse la iradiere X (25 până la 200 rads), fie tratate cu H2O2 (9,1 până la 291 microM) la Four grade C și gradul de migrare a ADN-ului a fost măsurat folosind o  tehnică de electroforeză cu microgel unicelular în condiții alcaline. Ambii agenți au indus o creștere semnificativă a migrației ADN, începând cu cea mai mică doză evaluată.

Modelele de migrație au fost relativ omogene între  celulele  expuse la raze X, dar eterogene între  celulele  tratate cu H2O2. O analiză a cineticii de reparație după expunerea la raze X de 200 rads a fost efectuată cu  limfocite  obținute de la trei persoane. Cea mai mare parte a reparației ADN a avut loc în primele 15 minute, în timp ce toată reparația a fost în esență completă la 120 de minute după expunere. Cu toate acestea, unele  celule  nu au demonstrat nicio reparație în această perioadă de incubație, în timp ce alte  celule au  demonstrat modele de migrare a ADN care indică mai multe daune decât cele induse de iradierea inițială cu raze X. Această tehnică pare a fi sensibilă și utilă pentru detectarea daunelor și repararea în celule unice .

Human Lymphocyte Antigen 96 (LY96) ELISA Kit
RDR-LY96-Hu-96Tests 96 Tests
EUR 665
Human Lymphocyte Antigen 96 (LY96) ELISA Kit
RD-LY96-Hu-48Tests 48 Tests
EUR 460
Human Lymphocyte Antigen 96 (LY96) ELISA Kit
RD-LY96-Hu-96Tests 96 Tests
EUR 636
Human 293T Whole Cell Lysate
LYSATE0032 200ug
EUR 150
Description: This cell lysate is prepared from human 293T using Boster's RIPA Lysis Buffer (AR0105) using a standard whole cell lysate protocol. The concentration was determined using the BCA assay process and then diluted using Dithiothreitol (DTT) and a reducing SDS sample loading buffer, heated for 5 minutes at 100˚C.
AAVS1 Positive Control EGIP 293T Reporter Cell Line
CAS606A-1 1 Vial
EUR 807
  • Category: Cas9
Gene Knock-Out HR Targeting Vector [MCS1-EF1?-RFP-T2A-Puro-pA-MCS2]
HR110PA-1 10 ug
EUR 1023
  • Category: HR Donors
Gene Knock-Out HR Targeting Vector [MCS1-EF1a-GFP-T2A-Puro-pA-MCS2]
HR410PA-1 10 ug
EUR 1023
  • Category: HR Donors
Gene Knock-Out HR Targeting Vector [MCS1-EF1a-RFP-T2A-Hygro-pA-MCS2]
HR510PA-1 10 ug
EUR 1023
  • Category: HR Donors
TARGATT? Knock-in iPSC Generation (Master Cell Line)
AST-1100 1 vial of 1X10^6 cells Ask for price
Description: 6 month
TARGATT? Knock-in Mouse Cell Line Generation Kit (Master Cell Line)
AST-7001 1 Kit Ask for price
Description: 6 month
HEK-293T cells
T0011002 One Frozen vial
EUR 455
TARGATT? Knock-in CHO Generation Kit (Master Cell Line)
AST-1200 1 Kit Ask for price
Description: 12 month
TARGATT? Knock-in HEK293 Generation Kit (Master Cell Line)
AST-1300 1 Kit Ask for price
Description: 12 month
Ly96 3'UTR Luciferase Stable Cell Line
TU112731 1.0 ml Ask for price
Ly96 3'UTR GFP Stable Cell Line
TU162731 1.0 ml Ask for price
Ly96 3'UTR Luciferase Stable Cell Line
TU212699 1.0 ml Ask for price
Ly96 3'UTR GFP Stable Cell Line
TU262699 1.0 ml Ask for price
LY96 3'UTR GFP Stable Cell Line
TU062782 1.0 ml
EUR 1394
LY96 3'UTR Luciferase Stable Cell Line
TU012782 1.0 ml
EUR 1394
HEK-293T Telomerase Over-Expressing Cell Pellet
abx069991-1Pellet 1 Pellet
EUR 398
  • Shipped within 1-3 working days.
Basic HR Targeting Vector [MCS1-LoxP-MCS2-MCS3-pA-LoxP-MCS4] for Gene Knock-In/Out
HR100PA-1 10 ug
EUR 938
  • Category: HR Donors
293AD Cell Line
AD-100 1 vial
EUR 461
Description: The 293AD Cell Line is derived from the parental 293 cells but selected for attributes that increase adenovirus production, including firmer attachment and larger surface area.
293AAV Cell Line
AAV-100 1 vial
EUR 508
Description: The 293AAV Cell Line is derived from the parental 293 cells but selected for attributes that increase AAV production, including firmer attachment and larger surface area.
293LTV Cell Line
LTV-100 1 vial
EUR 508
Description: The 293LTV Cell Line is derived from the parental 293 cells but selected for attributes that increase lentiviral production, including fimrer attachment and larger surface area.
293RTV Cell Line
RV-100 1 vial
EUR 508
Description: The 293RTV Cell Line is derived from the parental 293 cells but selected for attributes that increase retroviral production, including fimrer attachment and larger surface area.
Microplate Swing-Out Centrifuge
abx725026-1Unit 1 Unit
EUR 1476
  • Shipped within 10-15 working days.
Clinical Swing-Out Centrifuge
abx725027-1Unit 1 Unit
EUR 1476
  • Shipped within 10-15 working days.
Gene Knock-Out HR Targeting Vector w/Single Selection Marker (Blasticidin) and Negative Selection (TK) Against Random Integration
HR720PA-1 10 µg
EUR 1145
  • Category: HR Donors
293T Transfection Kit (1 mL)
293T Transfection Kit (0.2 mL)
293T Transfection Kit (1 mL)
293T Transfection Kit (0.2 mL)
293/GFP Cell Line
AKR-200 1 vial
EUR 572
Description: 293/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.
T47D/GFP Cell Line
AKR-208 1 vial
EUR 572
Description: T47D/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.
A549/GFP Cell Line
AKR-209 1 vial
EUR 572
Description: A549/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.
HeLa/GFP Cell Line
AKR-213 1 vial
EUR 572
Description: HeLa/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.
NIH3T3/GFP Cell Line
AKR-214 1 vial
EUR 572
Description: NIH3T3/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.
NIH3T3/Cas9 Cell Line
AKR-5104 1 vial
EUR 572
293/Cas9 Cell Line
AKR-5110 1 vial
EUR 572
HeLa/Cas9 Cell Line
AKR-5111 1 vial
EUR 572
LY96 antibody
70R-18335 50 ul
EUR 435
Description: Rabbit polyclonal LY96 antibody
LY96 antibody
70R-10270 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal LY96 antibody
LY96 Antibody
32480-100ul 100ul
EUR 252
LY96 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LY96. Recognizes LY96 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:500-1:2000, IHC:1:25-1:100
LY96 Antibody
DF6669 200ul
EUR 304
Description: LY96 Antibody detects endogenous levels of total LY96.
LY96 Antibody
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against LY96. Recognizes LY96 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
LY96 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against LY96. Recognizes LY96 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
LY96 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LY96. Recognizes LY96 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
LY96 siRNA
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
LY96 siRNA
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
LY96 Antibody
ABD6669 100 ug
EUR 438
LY96 sgRNA CRISPR Lentivector set (Human)
K1246301 3 x 1.0 ug
EUR 339
Gene Knock-Out HR Targeting Vector w/Dual Selection Markers (GFP+Puro) and Negative Selection (TK) Against Random Integration
HR700PA-1 10 µg
EUR 1145
  • Category: HR Donors
Gene Knock-Out HR Targeting Vector w/Dual Selection Markers (RFP+Hygro) and Negative Selection (TK) Against Random Integration
HR710PA-1 10 µg
EUR 1145
  • Category: HR Donors
EF010760 96 Tests
EUR 689
Human LY96 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
LY96 Recombinant Protein (Human)
RP018451 100 ug Ask for price
SKOV-3/Luc Cell Line
AKR-232 1 vial
EUR 572
Description: SKOV-3/Luc Cell Line stably expresses luciferase and otherwise exhibits the same characteristics of the parental cell line.
MCF-7/Luc Cell Line
AKR-234 1 vial
EUR 572
Description: MCF-7/Luc Cell Line stably expresses luciferase and otherwise exhibits the same characteristics of the parental cell line.
OVCAR-5/RFP Cell Line
AKR-254 1 vial
EUR 572
Description: OVCAR-5/RFP Cell Line stably expresses RFP and otherwise exhibits the same characteristics of the parental cell line.
Gene Knock-Out HR Targeting Vector with TK selection [MCS1-LoxP-EF1?-GFP-T2A-Puro-P2A-hsvTK-pA-LoxP-MCS2]
HR210PA-1 10 ug
EUR 1145
  • Category: HR Donors
LY96 sgRNA CRISPR Lentivector (Human) (Target 1)
K1246302 1.0 ug DNA
EUR 154
LY96 sgRNA CRISPR Lentivector (Human) (Target 2)
K1246303 1.0 ug DNA
EUR 154
LY96 sgRNA CRISPR Lentivector (Human) (Target 3)
K1246304 1.0 ug DNA
EUR 154
LY96 Blocking Peptide
33R-6768 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LY96 antibody, catalog no. 70R-10270
LY96 Blocking Peptide
DF6669-BP 1mg
EUR 195
LY96 Conjugated Antibody
C32480 100ul
EUR 397
LY96 cloning plasmid
CSB-CL013254HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 483
  • Sequence: atgttaccatttctgtttttttccaccctgttttcttccatatttactgaagctcagaagcagtattgggtctgcaactcatccgatgcaagtatttcatacacctactgtgataaaatgcaatacccaatttcaattaatgttaacccctgtatagaattgaaaggatccaaagg
  • Show more
Description: A cloning plasmid for the LY96 gene.
LY96 Polyclonal Antibody
A59694 100 µg
EUR 570.55
Description: fast delivery possible
LY96 Rabbit pAb
A1866-100ul 100 ul
EUR 308
LY96 Rabbit pAb
A1866-200ul 200 ul
EUR 459
LY96 Rabbit pAb
A1866-20ul 20 ul
EUR 183
LY96 Rabbit pAb
A1866-50ul 50 ul
EUR 223
LY96 Polyclonal Antibody
ABP59169-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human LY96 protein
  • Applications tips:
Description: A polyclonal antibody for detection of LY96 from Human, Mouse. This LY96 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LY96 protein
LY96 Polyclonal Antibody
ABP59169-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human LY96 protein
  • Applications tips:
Description: A polyclonal antibody for detection of LY96 from Human, Mouse. This LY96 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LY96 protein
LY96 Polyclonal Antibody
ABP59169-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human LY96 protein
  • Applications tips:
Description: A polyclonal antibody for detection of LY96 from Human, Mouse. This LY96 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LY96 protein
anti- LY96 antibody
FNab04900 100µg
EUR 585
  • Recommended dilution: WB: 1:200-1:2000
  • IHC: 1:50-1:200
  • Immunogen: lymphocyte antigen 96
  • Uniprot ID: Q9Y6Y9
  • Gene ID: 23643
  • Research Area: Signal Transduction, Metabolism, Cancer, Immunology
Description: Antibody raised against LY96
LY96 Polyclonal Antibody
ES11009-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against LY96 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
LY96 Polyclonal Antibody
ES11009-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against LY96 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
Anti-LY96 antibody
PAab04900 100 ug
EUR 412
pcDNA3.1-LY96 Plasmid
PVTB00381-2a 2 ug
EUR 356
Anti-LY96 antibody
STJ24433 100 µl
EUR 277
Description: This gene encodes a protein which associates with toll-like receptor 4 on the cell surface and confers responsiveness to lipopolysaccyaride (LPS), thus providing a link between the receptor and LPS signaling. Studies of the mouse ortholog suggest that this gene may be involved in endotoxin neutralization. Alternative splicing results in multiple transcript variants encoding different isoforms.
Anti-LY96 antibody
STJ192167 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to LY96
Platinum-E Retroviral Packaging Cell Line, Ecotropic
RV-101 1 vial
EUR 920
Description: Conventional cells used for retrovirus packaging, such as those based on NIH3T3 cells, have limited stability and produce relatively low yields of retrovirus, mainly due to the poor expression of retroviral structure proteins (gag, pol and env) in the cells. The Platinum Retroviral Packaging Cell Lines are based on the 293T cell line. They exhibit longer stability and produce higher yields of retroviral structure proteins. Plat-E cells contain gag, pol and env genes, allowing retroviral packaging with a single plasmid transfection.
Platinum-A Retroviral Packaging Cell Line, Amphotropic
RV-102 1 vial
EUR 920
Description: Conventional cells used for retrovirus packaging, such as those based on NIH3T3 cells, have limited stability and produce relatively low yields of retrovirus, mainly due to the poor expression of retroviral structure proteins (gag, pol and env) in the cells. The Platinum Retroviral Packaging Cell Lines are based on the 293T cell line. They exhibit longer stability and produce higher yields of retroviral structure proteins. Plat-A cells contain gag, pol and env genes, allowing retroviral packaging with a single plasmid transfection.
Platinum-GP Retroviral Packaging Cell Line, Pantropic
RV-103 1 vial
EUR 920
Description: Conventional cells used for retrovirus packaging, such as those based on NIH3T3 cells, have limited stability and produce relatively low yields of retrovirus, mainly due to the poor expression of retroviral structure proteins (gag, pol and env) in the cells. The Platinum Retroviral Packaging Cell Lines are based on the 293T cell line. They exhibit longer stability and produce higher yields of retroviral structure proteins. Plat-GP cells contain the gag and pol genes required for retroviral packaging; an expression vector is co-transfected with a VSVG envelope vector.
TARGATT? Knock-in iPSC Genotyping Kit
AST-1102 1 Kit Ask for price
Description: 12 month
Human Lymphocyte antigen 96 (LY96)
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 46.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Lymphocyte antigen 96(LY96),partial expressed in E.coli
LY96 ORF Vector (Human) (pORF)
ORF006151 1.0 ug DNA
EUR 95
LY96 ELISA Kit (Human) (OKAN05795)
OKAN05795 96 Wells
EUR 792
Description: Description of target: This gene encodes a protein which associates with toll-like receptor 4 on the cell surface and confers responsiveness to lipopolysaccyaride (LPS), thus providing a link between the receptor and LPS signaling. Studies of the mouse ortholog suggest that this gene may be involved in endotoxin neutralization. Alternative splicing results in multiple transcript variants encoding different isoforms.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.062 ng/mL
LY96 ELISA Kit (Human) (OKCD00545)
OKCD00545 96 Wells
EUR 831
Description: Description of target: Binds bacterial lipopolysaccharide (LPS) (PubMed:17803912, PubMed:17569869). Cooperates with TLR4 in the innate immune response to bacterial lipopolysaccharide (LPS), and with TLR2 in the response to cell wall components from Gram-positive and Gram-negative bacteria (PubMed:11160242, PubMed:11593030). Enhances TLR4-dependent activation of NF-kappa-B (PubMed:10359581). Cells expressing both LY96 and TLR4, but not TLR4 alone, respond to LPS (PubMed:10359581).5 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.1"MD-2, a molecule that confers lipopolysaccharide responsiveness on Toll-like receptor 4."_x005F_x005F_x000D_Shimazu R., Akashi S., Ogata H., Nagai Y., Fukudome K., Miyake K., Kimoto M._x005F_x005F_x000D_J. Exp. Med. 189:1777-1782(1999) [PubMed] [Europe PMC] [Abstract]Cited for: NUCLEOTIDE SEQUENCE [MRNA] (ISOFORM 1), VARIANT GLY-56, FUNCTION, INTERACTION WITH TLR4, SUBCELLULAR LOCATION.Ref.8"MD-2 enables Toll-like receptor 2 (TLR2)-mediated responses to lipopolysaccharide and enhances TLR2-mediated responses to Gram-positive and Gram-negative bacteria and their cell wall components."_x005F_x005F_x000D_Dziarski R., Wang Q., Miyake K., Kirschning C.J., Gupta D._x005F_x005F_x000D_J. Immunol. 166:1938-1944(2001) [PubMed] [Europe PMC] [Abstract]Cited for: INTERACTION WITH TLR2 AND TLR4, FUNCTION.Ref.9"Secreted MD-2 is a large polymeric protein that efficiently confers lipopolysaccharide sensitivity to Toll-like receptor 4."_x005F_x005F_x000D_Visintin A., Mazzoni A., Spitzer J.A., Segal D.M._x005F_x005F_x000D_Proc. Natl. Acad. Sci. U.S.A. 98:12156-12161(2001) [PubMed] [Europe PMC] [Abstract]Cited for: DISULFIDE BONDS, GLYCOSYLATION, SUBCELLULAR LOCATION, FUNCTION, INTERACTION WITH TLR4.Ref.11"Crystal structure of the TLR4-MD-2 complex with bound endotoxin antagonist Eritoran."_x005F_x005F_x000D_Kim H.M., Park B.S., Kim J.-I., Kim S.E., Lee J., Oh S.C., Enkhbayar P., Matsushima N., Lee H., Yoo O.J., Lee J.-O._x005F_x005F_x000D_Cell 130:906-917(2007) [PubMed] [Europe PMC] [Abstract]Cited for: X-RAY CRYSTALLOGRAPHY (1.7 ANGSTROMS) OF 19-158 IN COMPLEX WITH TLR4 AND LIPOPOLYSACCHARIDE ANALOG, SUBUNIT.Ref.12"Crystal structures of human MD-2 and its complex with antiendotoxic lipid IVa."_x005F_x005F_x000D_Ohto U., Fukase K., Miyake K., Satow Y._x005F_x005F_x000D_Science 316:1632-1634(2007) [PubMed] [Europe PMC] [Abstract]Cited for: X-RAY CRYSTALLOGRAPHY (2.0 ANGSTROMS) OF 17-160 IN COMPLEX WITH LIPID IV-A, DISULFIDE BONDS, GLYCOSYLATION AT ASN-26 AND ASN-114. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.062 ng/mL
LY96 ELISA Kit (Human) (OKCA01342)
OKCA01342 96 Wells
EUR 846
Description: Description of target: Binds bacterial lipopolysaccharide (LPS). Cooperates with TLR4 in the innate immune response to bacterial lipopolysaccharide (LPS), and with TLR2 in the response to cell wall components from Gram-positive and Gram-negative bacteria. Enhances TLR4-dependent activation of NF-kappa-B. Cells expressing both LY96 and TLR4, but not TLR4 alone, respond to LPS.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 31.25 pg/mL
LY96 ELISA Kit (Human) (OKDD00383)
OKDD00383 96 Wells
EUR 857
Description: Description of target: This gene encodes a protein which associates with toll-like receptor 4 on the cell surface and confers responsiveness to lipopolysaccyaride (LPS), thus providing a link between the receptor and LPS signaling. Studies of the mouse ortholog suggest that this gene may be involved in endotoxin neutralization. Alternative splicing results in multiple transcript variants encoding different isoforms.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.06 ng/mL
PinPoint-FC 293T Platform Cell Line for Targeted Gene Insertion (with PinPoint site already placed)
PIN320A-1 >2x10^5 cells
EUR 3104
  • Category: PinPoint Integrase Tools
Total Protein - Murine Embryonic Stem Cell Line D3
CBA-305 500 ?g
EUR 345
  • Isolated from mouse ES-D3 cell line
  • Presented as 500 µg at 1 mg/mL in NP-40 Solubilization Buffer
Ly96 sgRNA CRISPR Lentivector set (Rat)
K6749501 3 x 1.0 ug
EUR 339

Leave a Reply

Your email address will not be published. Required fields are marked *